Digital download
$25.00
- Availability
- In stock
- Checkout
- One item
Need a hand?
Message us on WhatsApp for payment or download support.
SYSEN5630
Assignment 1
Due: 5pm EST, 2/08/2025
1. Regular expression patterns
Write regular expressions matching the following patterns. The matching should cover the entire input string (not partial).
1 import re
2
3 def isMatch(s, p):
4 """
5 :type s: str. Input string
6 :type p: str. Regular expression
7 :rtype: bool
8 """
9 print(’Input: s="%s", p="%s"’ % (s, p))
10 m = re.match(p, s, re.A)
11 r = m is not None and m.end() == len(s)
12 print(’Output: %s’ % r)
1 >> isMatch("begn", "beg.n")
2 Input: s="begn", p="beg.n"
3 Output: False
4
5 >> isMatch("begin", "beg.n")
6 Input: s="begin", p="beg.n"
7 Output: True
(a) Write one regular expression that matches DNA (strings of A,C,G, or T) in upper/lower case
Return True:
• acgtagaatgacatactgactgactactagcatgactgactgactg
• catcatcatcatcatcatcatcatcatcatcatcat
• ACtCtATCtCTAtcttAtaCtCTAtgTGCgGAGAggGag
• catcatcatcatmeowcatcatmeow
Return False:
• tagtagtagtagbodyspraytagtagtagtag
• actg actga actga tacgtagtc tag atcg actgac tg a
• 12345
(b) Write one regular expression that matches words containing at least two vowels (a, e, i, o, u, A, E, I, O, or U).
Return True:
• Jamie
• Michael
• Staci
• David
• Phillip
• either
Return False:
• Shiny
• Zack
• Katlyn
• Chris
(c) Write one regular expression that matches dollar amounts of at least $1000.00.
Return True:
• $1000.01
• $1234.12
• $1221222121212.00
Return False:
• 1000.00
• $010.00
• $499.99
• $1000.121
2. Regular expression for sentence split
The chemprot sample abstracts-10 .tsv file contains plain-text, UTF8-encoded CHEMPROT sample set PubMed record in a tab-separated format with the following three columns:
• Article identifier (PMID, PubMed identifier)
• Title of the article
• Abstract of the article
A total of 10 records are provided in this sample set.
(a) Write a Python script. and use [ˆ . !?] * [ . !?] to extract sentences from each abstract. How many sentences can be extracted from each abstract (NOT the title)?
|
PMID |
Number of sentences in the abstract (3rd column) |
|
Example: 10471277 |
11 |
|
23150485 |
|
|
23155202 |
|
|
23477624 |
|
|
23044094 |
|
|
23220749 |
|
|
9950599 |
|
|
23615073 |
|
|
23147415 |
|
|
23643664 |
|
(b) Give 2 examples that the extracted text is not a complete sentence and explain why the regular expres- sion does not work.
(c) Submit the runnable script.
3. Text preprocessing
The chemprot sample abstracts .tsv file contains plain-text, UTF8-encoded CHEMPROT sample set PubMed record in a tab-separated format with the following three columns:
• Article identifier (PMID, PubMed identifier)
• Title of the article
• Abstract of the article
In total 50 records are provided in this sample set, where each line contains a single PMID, title, and abstract separated by tabulators.
(a) Calculate the total number of sentences, the number of unique words, and the number of unique lemmas in all abstracts.
|
|
NLTK |
Spacy |
Stanza |
|
Sentences |
|
|
|
|
Unique Words |
|
|
|
|
Unique Lemmas |
|
|
|
(b) Upload the source codes.
(c) Find 2 tokenization examples in the dataset that Spacy and Stanza return differently.
(d) Find 2 lemmatization examples in the dataset that Spacy and Stanza return differently.