CEGE0030 – Roads and Underground Infrastructure TUNNELS COURSE WORK - This coursework will be done in groups of 3 persons. - As part of the coursework, you need to define a group leader to communicate with the coursework coordinator - As a group you must organise meetings to discuss the coursework progression and create minutes that will be used to demonstrate how you divided the work and how you have informed your peers. A simple and effective model of the minutes is available for download on moodle and these must be attached to the end of your submitted coursework. - These documents are the only way to calculate a scale factor to derive the individual mark, from the final coursework mark. Small differences in workload are expected but you should balance the proportion of work amongst group members. Introduction and scope of the project Your team is required to design the northern branch of the Crossrail 2 (CR2) line, going from Alexandra Palace to Seven Sisters (Figure 1); however, rather than having a stop at Turnpike Lane station, your stop must be at Wood Green station. New Southgate will be a terminal station and the exact location of the portal has not been defined yet. Your design should consider that the springline of your tunnel is located at a depth of 20m below Alexandre Palace station, at an alignment similar to the railway alignment aboveground; this is your starting point. The running tunnels, at Seven Sisters, must be pointing south, towards Dalston Kingsland, aligned with the A10 near Seven Sisters station. The client also wants Seven Sisters station on the CR2 line, to have access to both South Tottenham station on theovergroundlineandSevenSistersStationontheVictorialineand Rail Network. Therefore, you must decide where the platform. tunnels will be located, to give the best possible access to the lines mentioned above. During the design, the following aspects (not limited to) must be considered: -A geotechnical soil profile along the route must be created, together with the likely problems that may be encountered during the excavation of the tunnels. - Horizontal and Vertical alignments of the tunnel, as well as the geology excavated must be supplied. - The line will be composed by twin tunnels with an internal diameter of 7 m. - A definition of the type of TBM machine that shall be used, as well as an estimation of the pressures required by the ground, in order to allow excavation to proceed safely must be calculated and shown in the report. -Shafts for ventilation and emergency access to the tunnels must be designed along the line. Your team must decide what is the best location for the shafts, as well ashow it will influence the alignment. A small paragraph with an explanation must be provided. Figure 1 – Part of the Crossrail2 project to be designed inside the red circle. -Platform. tunnels must be located as near as possible to the existing stations. At this stage stations will not be redesigned but connection to the existing stations and location of the escalator tunnels must be specified on the drawings of your proposed station and connections. -A calculation of the stresses likely to be encountered on the tunnel lining and caused by the soil load, together with a surcharge of 65kPa, must be calculated. -A settlement through must be created considering a face loss of 0.25, 0.5 and 1.0%, over the whole area of the tunnel. -An analysis of the structures that are likely to suffer from differential settlements, between Wood Green and Seven Sisters stations must be performed. This must include listed buildings. Deliverable You are required to write a report, with no more than 2000 words in the main text (excluding captions, references, summary and index), explaining briefly your considerations and assumptions. Most of the information should be conveyed with drawings and sketches and there is no limit for these. Please make sure that your drawings or sketches have scales and areworded to convey the right information. Sketches without a number or a name will be ignored and not considered on the marks. At the end of your coursework, a set of meeting dates and minutes, describing what was agreed and spoken during the meetings may be submitted as an appendix – there is no limit of words. This part will only be used in case there are disputes related how much each team member has contributed to the final report.
INU1110 – Assessment 2 Brief for Students February 2025 “Evidence and evaluate the main reasons for the low economic growth experienced in the UK economy between January 2020 and January 2025”. This second assessment for the module INU1110 – Introduction to Economics is a creative digital project – A VLOG or Video blog based on the work of a group of 4 or 5 students. It is worth 60% of each student’s final mark. Crucially, 30% of the total marks are peer-marked 2. The final deadline for A2 assessment - Completed Video Blog using MS SWAY By 9.00 on Monday 28th April ((week 12). Each group will submit a VLOG presented in MS SWAY using an interactive visual design that includes 1000 words of relevant text, plus graphics, diagrams, TV and social media footage, sound files and student video with academic references /citations. 3. Deadline for draft version for teacher feedback The draft will be submitted on Sunday 24.00 on 10th March (week 7). The draft VLOG with include two examples of potential theory, one detailed example of effect on economic actor, one piece of edited footage and a video recording for each student, each speaking for a minimum of 1 minute on a relevant topic. It will include a minimum of 5 references including academic ones. 4. VLOG marking scheme Marks 4.1.Develop points to level of detail expected of an academic study (reference, 10 cite, state, evidence, illustrate and apply concepts from macroeconomics relevant to context. 4.2. Use relevant macroeconomic theory to analyse performance trends, causes 15 and effects on economic growth over the period (indicators incl.UK Interest Rates, Inflation, Balance of Payments, Business Cycle events, Investment, Employment, Skills, GDP, Productivity, the SR & LR, Aggregate Demand and Aggregate Supply. 4.3. Use relevant policy analysis to evaluate Government interventions to stimulate 15 UK Economic growth including specific fiscal and/or monetary policies, supply-side and/or demand-side policies. Use AD&AS analysis in your answer. 4.4 Provide relevant examples, (one for each of the four economic actors: firms, 15 households, governments, and overseas trading partners). Demonstrate the impacts of levels of economic growth rates. Use indicators such as the standard of living, per capita incomes, debt, borrowing, Saving, Consumption, Wages, investment Assets. 4. 5. Delivery of Blog Posts (Presentation & Technical Production Performance). 15 4.6. Student participation (peer assigned mark subject to teacher endorsement). 30 5. Media Platform The project is structured to make full creative and innovative use of MS SWAY. This digital media platform. can be used to present all audio-visual, social, sound and TV video media. Organise your work and sources using Teams, or WhatsApp or . Students should collaborate intensively over 10 weeks to design and execute the work. 6. Narrative The VLOG project will tell an audio-visual multimedia story answering the question “Evidence and evaluate the main reasons for the low economic growth experienced in the UK economy between January 2020 and January 2025”. 7. Relevant Topics & Concepts for Analysis The list of topics above is not exclusive as there may be many others not indicated. Choose a minimum of 4 Key Topics from Macro and 3 from Micro in your narrative. 8. Structure of VLOG Content Present your work under the following headings i) Executive Summary (list of 10 key findings/ incl. thesis statement - main answer). ii) Introduction – Economic Growth Definition. UK context, comparative GDP growth. iii) Relevant Macro. Theory (Relevant concepts, sources of growth, relevant policy). iv) Relevant Microeconomic Theory (incl. Key growth industries and drivers of growth) v) Analysis of UK GDP Trends /Policy Responses (Identify success /failure of Policies). vi) Relevant Examples - Impact of growth rates on Key Economic Actors in the UK. vii) Conclusion viii) Academic References & Media Index.
Assignment: Group Case Study 1 Title: CLP Group: Environmental, Social, and Governance Factors and Their Effects on Valuation Due Date: February 7, 2025 (11:59 p.m.) Submission Method: Avenue to Learn Each group will analyze the case study on CLP Group and prepare a memo-style. response addressing the questions outlined below to facilitate Susan Chen in achieving her objective. Your memo should be concise and limited to three pages, excluding appendices. The appendix may include supporting tables, calculations, graphs, and other relevant materials if necessary. You will be evaluated based on your ability to connect the concepts from the case study to course materials, the depth of your analysis, and the clarity of your writing. Late submissions will be subject to grade deductions per course policy. The memo should clearly address the following questions: 1. What is the key objective of Susan Chen? (1 point) 2. What are some important mechanisms that could affect CLP’s financial performance? Identify at least three key mechanisms, which may include factors, actors, or macro trends (e.g., customers, employees, etc.). Explain how these mechanisms would influence CLP's valuation, specifying the relevant valuation channels in a Discounted Cash Flow (DCF) model. (9 points) 3. Complete Exhibit 9B from the case study package (A) by: (i) Justifying how each of the key mechanisms identified in Question 2 may impact one or more of the core business drivers of utility companies as outlined in Exhibit 9B. If necessary, you may add additional core drivers to the Exhibit based on the key mechanisms you identified. (3 points) (ii) Identifying at least five key performance indicators (KPIs) that are considered material, after clearly defining "material" to Susan. Justify the selection of these material KPIs. Additionally, provide examples of KPIs that are immaterial and briefly explain why they do not meet the materiality criteria. (12 points) 4. Do you think that the market has already priced ESG factors into CPL’s value as revealed by the base case valuation? Discuss why or why not. (2 points) 5. Develop a valuation approach integrating ESG factors to support Susan’s objective. Incorporate relevant KPIs and disclosed ESG performance data, and justify the projected impacts on cash flows, growth rates, and the cost of capital based on Susan’s rationale. (8 points) 6. Which stage of Sustainable Finance does this approach align with based on class material? Briefly discuss any shortcomings or limitations of this approach. (2 points) Please ensure clarity, proper grammar, and correct spelling in your writing. (5 points)
KQK 7003 – 15% Due date 12 January Analysis and Study of a Thermal System This is a group project involving 5 students. Each student is required to contribute to the analysis and study of a thermal system. You can choose either Project 1 or Project 2. The report should follow the Table of Contents (TOC) provided below. The cover page must include the title of the project as well as the names, matric numbers, and contribution percentages of each group member (see below). i. Student name 1 : Matrik number : Contribution percentage (%) ii. Student name 2 : Matrik number : Contribution percentage (%) iii. Student name 3 : Matrik number : Contribution percentage (%) iv. Student name 4 : Matrik number : Contribution percentage (%) v. Student name 5: Matrik number : Contribution percentage (%) ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ PROJECT 1 : Analysis and Performance Evaluation of Vapor Chambers as an Advanced Thermal System 1.0 Introduction 1.1 Overview of Thermal Management Systems 1.2 Introduction to Vapor Chambers 1.3 Objectives of the Study 1.4 Scope and Limitations 2.0 Fundamentals of Vapor Chamber Technology 2.1 Working Principle of Vapor Chambers 2.2 Phase Change Heat Transfer 2.3 Comparison with Other Thermal Management Systems 2.3.1 Heat Pipes 2.3.2 Heat Sinks 2.4 Factors Influencing Vapor Chamber Performance 3.0 Design Considerations 3.1 Geometric Design and Material Selection 3.2 Working Fluid and Capillary Wick Structure 3.3 Heat Input Distribution and Heat Spreading 3.4 Effect of Orientation and Gravity 4.0 Heat Transfer Mechanisms in Vapor Chambers 4.1 Evaporation and Condensation Process 4.2 Capillary Action and Wick Functionality 4.3 Temperature Distribution and Steady-State Conditions 5.0 Performance Analysis 5.1 Thermal Resistance and Conductivity 5.2 Heat Spreading Ratio 5.3 Temperature Gradient Analysis 5.4 Comparison with Other Heat Dissipation Methods 5.4.1 Heat Pipes 5.4.2 Traditional Heat Sinks 5.5 Factors Affecting Thermal Performance 6.0 Applications of Vapor Chambers 6.1 Electronic Cooling Systems 6.2 High-Performance Computing 6.3 Spacecraft and Aerospace Applications 6.4 Power Electronics and Renewable Energy 6.5 Emerging Applications and Future Trends 7.0 Experimental Analysis (Optional) 7.1 Experimental Setup and Methodology 7.2 Data Collection and Analysis 7.3 Results and Discussion 7.4 Limitations and Accuracy of Results 8.0 Conclusion 8.1 Summary of Key Findings 8.2 Limitations of Vapor Chambers 8.3 Future Research Directions 8.4 Conclusion on the Role of Vapor Chambers in Thermal Management References (Recent and min 25 references) +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ PROJECT 2 : Analysis and Performance Evaluation of Jet Impingement as an Advanced Thermal System 1. 0 Introduction 1.1 Overview of Thermal Management Systems 1.2 Introduction to Jet Impingement Cooling 1.3 Objectives of the Study 1.4 Scope and Limitations 2.0 Fundamentals of Jet Impingement Cooling 2.1 Working Principle of Jet Impingement Cooling 2.2 Heat Transfer Mechanism in Jet Impingement 2.3 Factors Affecting Heat Transfer Efficiency 2.4 Comparison with Other Cooling Techniques 3.0 Design Considerations 3.1 Nozzle Geometry and Jet Characteristics 3.2 Effect of Jet Velocity and Flow Rate 3.3 Surface and Heat Source Configuration 3.4 Choice of Fluid for Cooling 4.0 Heat Transfer in Jet Impingement 4.1 Nusselt Number and Thermal Performance 4.2 Temperature Distribution and Wall Effects 4.3 Enhancement Techniques for Jet Impingement Cooling 4.4 Scaling Effects and Application Challenges 5.0 Performance Analysis 5.1 Analytical Models for Jet Impingement Cooling 5.2 Computational Fluid Dynamics (CFD) Simulations from references 5.3 Experimental Studies on Heat Transfer Performance 5.4 Influence of Operational Parameters on Cooling Efficiency 6.0 Applications of Jet Impingement Cooling 6.1 Electronics and Semiconductor Cooling 6.2 Power Electronics and High-Performance Systems 6.3 Aerospace and Turbomachinery Applications 6.4 Emerging Applications in Renewable Energy and Automotive Industries 7.0 Experimental Analysis (Optional) 7.1 Experimental Setup and Methodology 7.2 Data Collection and Analysis 7.3 Results and Discussion 7.4 Limitations and Accuracy of Experimental Results 8.0 Conclusion 8.1 Summary of Key Findings 8.2 Challenges in Jet Impingement Cooling 8.3 Future Research Directions 8.4 Conclusion on the Role of Jet Impingement in Thermal Systems References (Recent and min 25 references)
MTH 360 - Project 1 Introduction Personal finance, investing, and overall financial literacy are some of the most directly impactful applications of the topics in this course. Most notably, saving and investing for retirement is extremely important but often scary because of the uncertainty of the market. While this project aims to help alleviate some of the nervousness, it should be said that it can never be eliminated – the market is uncertain, and it always will be! Whenever the “market” is referenced, there could be many possibilities, but usually is some broad index measure. An index is usually the (weighted) average of the stock price of some number of companies. For example, the S&P 500 (Standard and Poor’s 500 Index) is the weighted average of the largest 500 companies traded on an exchange (either the New York Stock Exchange (NYSE), National Association of Securities Dealers Automatic Quotation System (NASDAQ), or Chicago Board of Exchange (CBoE)). Other indexes include the Dow Jones Industrial Average (DJIA) and the NASDAQ composite. The index itself is not and cannot be traded, though there are other funds (index funds, exchange traded funds (ETFs), etc.) that mimic the indexes themselves as closely as possible and these funds can be traded. These indexes do change over time, both in composition and definition. For example, the S&P started as the S&P Composite, which contained only a few companies, then grew to 90 companies in 1926, and 500 companies in 1957, launching the S&P 500. Another index is the Consumer Price Index (CPI), which is not a traded index at all. This concept is completely different than a market index. The CPI is a measure of how expensive a basket of goods costs, for example, the price of vehicle fuel, food, and utilities. The CPI is a measure of inflation, showing how much things cost in relation to various points in history. The CPI helps us determine real dollars, which is the raw cost of something free of inflation, or, in other words, so that two dollar-figures in different eras can be compared equivalently. This helps us to determine whether the market returns are really what they calculate to be. For example, if the market returns 2% one year but inflation is 3%, the growth of the cost of goods exceeded the growth of the index that we’ve presumably invested in, which means we’ve actually lost purchasing power of our account. We will eventually study inflation, but not yet. Lastly, the Trinity Study is a study of safe withdrawal rates. This study examined different portfolio mixes (different percentages of stocks and bonds) along with withdrawal rates and market return rates. The ultimate retirement conundrum is how much money you can withdraw from your retirement account before running out of money, yet, optimally, you want to spend as much of that money as possible. Considering both randomness of the market and in life experiences, the correct withdrawal amount is certainly quite the conundrum. The results of the study can be read here: https://www.aaii.com/files/pdf/6794_retirement-savings-choosing-a-withdrawal- rate-that-is-sustainable.pdf Once again, we will eventually study stocks and bonds, but not yet. For the purposes of this project, we only need the raw account values of some investment fund, not necessarily its composition. As a study of the market and benchmarking, just how good are the returns of the market? Do you think you could do better? [Rhetorical questions only; do not answer in the project itself]. Problem 1 You are provided a link to a spreadsheet containing the S&P Composite values dating back to 1871: • https://shillerdata.com/ o Scroll down and download the ie_data.xls data set Use only the information contained in the Data tab This contains monthly values of the index along with the dividends paid, earnings, and the consumer price index at the time, among other information. Right now, you will only concern yourself with the S&P Composite values. 1. Use only annual data from 1871 – 2020. Paste this information into the Shiller Data Dump sheet in the spreadsheet provided on D2L. You may copy this data into other sheets as needed. I recommend that the data dump sheet is unmodified in case you make a mistake somewhere and need the original data again, you don’t have to download or recopy anything from multiple files. a. Use the information starting in January of each year. To filter out these other months, you can use Excel’s filter tool, create an indicator variable for January of each year, use the ROW function, or some combination of these, among other options. That means your final row should be January 2020. 2. Calculate various return rates. a. Calculate the 1-year, 5-year, 10-year, and 20-year moving geometric average annual return rates for all available period ranges. i. For example, for a 5-year annual return rate, you will calculate the 5-year average annual effective return rate for the 5-year period starting in 1871 (e.g. the range 1871 – 1875), again for the period starting in 1872 (e.g. the range 1872 – 1876), et cetera, all the way to the period ending in 2019. 1. This end will use the January 2020 data, but this is essentially the same as the end of December 2019. 2. Repeat this for all 1-year, 5-year, 10-year, and 20-year periods. b. Graph each of the sequences of average annual return rates vs. time (period) on separate bar graphs (e.g. all 1-year returns on one graph, all 5-year average annual returns on a different graph). i. What do you notice within the graphs? ii. What do you notice across the graphs? c. Calculate the percentage of positive return rates for each of the moving geometric averages. For perspective, also calculate the percentage of non-positive return rates for each of the moving averages. i. What do you notice about these percentages across the length of the averaging periods? 1. How does this relate to 2.b.i and 2.b.ii? ii. In a forecasting perspective, these percentages can be viewed as probabilities. In other words, these figures project answers to the question “What is the probability that my account value will grow in the next x-years?” 1. Keep in mind that magnitude is important, not just these binary results. If the returns are 0.1%, 0.2%, and -50%, the account has a 67% chance to grow, but the overall account value would be substantially less. However, this would be reflected as a negative annual average return rate over the three-year period, which is much more indicative of the growth of the account. d. Create a five-number-summary, arithmetic and geometric means of the return rates, and histograms of return rates. i. For each of the n-year periods above, calculate the five-number- summary: minimum, 1st quartile, median (2nd quartile), 3rd quartile, and maximum. 1. The quartiles are each 25th percentile. For instance, the 1st quartile is the 25th percentile, the median (2nd quartile) is the 50th percentile, etc. a. A percentile is the value for which p% of the data lies below. You may calculate these using the PERCENTILE function. 2. Calculate the arithmetic mean and geometric mean of the returns for each set of return periods. a. Compute the arithmetic mean of the return rates. i. This is the “traditional” average: b. Compute the geometric mean of the return rates. i. This is the “compounded” average: 3. Make a histogram of the data using bins of 2% ranging from the minimum to the maximum value. Histograms show the percentage of values that fall within these ranges. This is, essentially, a distribution of the return rates, which is, furthermore, a set of probabilities of the return rates. a. A bin is essentially a “bucket” that data are placed in. For instance, return rates of 4.3%, 1.5%, 4.9%, 1.2%, and 4.0% would have a 1% bin containing a count of 2, and a 4% bin containing a count of 3. Equivalently, the percent in each bin could also be displayed instead of the count, meaning that the 1% bin would have a 40% value, and the 4% bin would have a 60% value. e. Exploratory (not graded) i. Compare the histograms, bar graphs, etc. and draw your own conclusions about returns over different investing periods. You may like to change the bin size, clamp the return rate region (e.g. have an underflow bin of ≤ 10% and / or an overflow bin of ≥ 15%), or even change the date range (for example, analyzing a more modern period of something like 1950+ or maybe the most recent two decades.). Problem 2 - The 4% Rule and Sequencing Risk The Trinity Study is one of the first, if not the first, studies to propose the 4% rule: withdrawing 4% of your initial portfolio value is a safe amount to withdraw during retirement (with the goal of not going into ruin). Of course, this is never 100% guaranteed, but it gives a place to start. For example, if a portfolio has $1,000,000, then, ignoring any other deposits or returns, withdrawing 4% ($40,000) each year would last 25 years on the principal alone, which is a long enough period for many people entering retirement, say, at age 65. Notice that this is a static withdrawal rate. Many suggest that a dynamic withdrawal rate is much better which could be either 1) withdrawing 4% of the current portfolio value, or 2) withdrawing lower or higher than 4% depending on market conditions. 1. You are provided with an Excel file on D2L containing sequences of return rates over a period of 25 years. There are three sequences – sequence one is a random order of return rates; sequence two contains the exact same values but in ascending order; sequence three is a constant sequence. For all sequences: a. Compute the arithmetic mean of the return rates. i. This is the “traditional” average: b. Compute the geometric mean of the return rates. i. This is the “compounded” average: c. Assume that you have an account with $1,000,000 currently at time 0. Compute the account values at the end of each year assuming interest is credited at the end of the year and withdrawals of 4% of the initial account value (e.g., $40,000) occur at year-end as well. 2. Financial advisors often charge a fee for their services in managed accounts. These are seemingly small(ish) fees, usually around 1-2% of the return, though, as you’d imagine, over 20+ years, these fees certainly add (compound) up. a. For the random sequence of returns, apply a 1% additive reduction to the return rates and compare the account values to those without the reduction. [An additive reduction of 1% is called a reduction of 100 basis points to avoid confusion with a 1% multiplicative reduction, that is, a 99% multiplier: Ex: (1+0.05 – 0.01) vs. (1+0.05*0.99)] i. Calculate the ratio of account values for comparison. For example, if one account has $1000 and the managed account (with the fee) has $900, then the managed account has 90% of the account without the fee. Alternatively, this is a 10% reduction in the account value. b. Repeat with the ordered sequence. c. Repeat with the constant sequence. d. Exploratory (not graded): Change the annual effective interest rate and the fee and see the effects of the fee. Try extending the investing period (e.g. change 25 years to 40 years, etc.). The interaction of the parameters can be quite surprising. For example, a return rate of 1% will allow the account to grow, and compound interest will allow a lot of growth over a long period of time. After 20 years, the account should have grown by more than 20% (it would be 20% using simple interest, so compound interest should be more). If the management fee is 1%, then the net growth of the account is 0%, and any fee larger than 1% will reduce the amount in the account. The same “intuitive” figures would hold for, say, a 5% return rate – the account should have at least doubled after 20 years (5% × 20 years = 100% increase), and much more than that for compound interest, so how much would this have been reduced by introducing a fee of various values? The opposite scenario is also true – suppose that a manager takes a 1% fee but realizes an extra 2% over what you would do by yourself, then you are up that extra 1%, not down 1%. Typically, people do better with investing advisors than on their own, but this shows you just how much better the advisors need to do to be “worth it.” e. For reference, calculate two lump sum figures: (1. 10)25 , and (1.09)25 and compare their ratios. i. Exploratory: Change the interest rate amounts so you can see the disparity of the difference effect. For instance, a principal of $100,000 at 6% produces an accumulated value of about $430,000. A 4% rate produces about $267,000, which is about a 40% reduction in account value. f. For the constant sequence, check the account value at time 25 by using standard actuarial figures / annuity figures such as i. Note: This means that the prior calculations in parts (a) – (e) should be done without these formulas (reminder: see the Grading Comments below). 3. Exploratory (not graded) a. Visit this website here: i. https://engaging-data.com/early-retirement-calculators-and-tools/ b. This website contains a few financial calculators with great graphs. My personal favorite is the one that incorporates mortality into the analysis and projection, but this material is more for STT 455 / 456. You will notice a lot of similarities in these graphs and this project, though this project is more focused on the pure mathematics of it all and demystifying how the above website creates these graphs and analyses. Problem 3 - Your Own Investment and Timing the Market One standard piece of investing advice is that it is not about timing the market, it’s about time in the market. Studies have shown that missing only a small fraction of the best trading days over a 20-year period can reduce a final portfolio value by over FIFTY percent. Roughly speaking, there are approximately 250 trading days in a year, which is 5000 trading days in 20 years, and missing as something as small as the 10 best trading days out of the 5000 can result in this 50% portfolio value reduction. You have a pretend $10,000 to invest in the stock market. You may invest this money in the market however you choose, but it must be a traded stock on the exchange. An easy way to search for companies is obviously through any search engine, but also something like YahooFinance where you can search for companies by sector (e.g. technology, medicine, etc.) and see the ticker to track (e.g. Microsoft is MSFT, Apple is AAPL (yes, two As and not Ps)). This problem is semester-long and is for you to track on a weekly basis, so I would recommend keeping this simple, but here are a few guidelines: 1. Your performance does not affect your grade. This is simply for fun, but also to increase your competency and mastery of portfolio values, return rates, buying / selling, etc. 2. You must participate. This means you cannot simply hold $10,000 and do nothing with it. a. Yes, holding cash is a valid strategy, but we’re trying to do some math on the topic, and zero trading volume doesn’t lend itself well to computation. b. You can hold some cash as part of a trading strategy (e.g. you want some cash to be able to purchase something at a better price), but not all $10,000. 3. No cryptocurrencies, non-fungible tokens, crowd-funded funds, real estate, art, or anything that isn’t basically a stock. a. Yes, these are valid forms of investment, but we’re trying to keep it simple. Your tasks are: 1. Record the date and fund value on that date. Keep the frequency regular, such as recording the fund value every Saturday when the market is closed and prices have settled. 2. Your fund value can be composed of different assets, so if you choose to mix assets, you’ll have to record the amount of shares that you buy, sell, or otherwise trade, and the amount of cash you’re holding. You may trade fractional shares. 3. Calculate the weekly return rates of your total portfolio. a. Remember that any cash is also part of the portfolio value. 4. Plot the weekly portfolio values and return rates versus time on separate graphs. Additionally: 1. Record the value of the S&P 500 (^SPX) and calculate the weekly return rates. a. Optionally, you may like to calculate the total return (the cumulative return) to compare how your portfolio is doing against this benchmark. We will eventually do this comparison in Project 4 when we have much more data, so this is not necessary at this moment. The columns are: • Date – The date you record your prices and calculate your values. These should be exactly weekly periodic (e.g. every Saturday). • Ticker – The “abbreviation” or “code” for the security. • Buy / Sell / Hold – Enter what you are doing this week. If buying a new security, enter “Buy.” If you are selling, enter “Sell.” If you are doing nothing, enter “ Hold.” • Price per Share – The current trading price of the security. • # Shares – How many shares of the security you are trading or currently own. • Cost – The total cost of the purchase (or negative if sold). This will be 0 if you have no activity. • Cash – How much leftover cash you are holding. • Portfolio Value – This is the value of your assets, equal to the current price per share times the number of shares (for every security) plus any leftover cash. If you have multiple securities, you should have an additional entry for the total portfolio value: the sum of the values of your securities and cash. • Return Rate – This is the weekly return rate of your securities. Ultimately, I am interested in the return rate of your total portfolio (which can be one single security), but you may like to keep track of how each security is individually performing. One other item you may find useful is the weight of each security in your portfolio, which would be the percentage value contribution of the security to the entire portfolio. For instance, you may initially buy two securities that compose 50% of the portfolio each (say, you spend $5000 on two securities, but perhaps at different prices and / or amount of shares), but, after some time, one security may be worth $8000 and another worth $4000, and then your portfolio has a 67%/33% split. This can lead to sensitivity in your portfolio with having too much importance on one single security. You may decide to rebalance, go all-in, or do nothing, but it may be of interest to you to know. This is not necessary, but you may use the column and include it if you so choose. As you will come to learn in this class, calculating the total portfolio return can be calculated directly from the total portfolio value or it can be reconstituted by using the individual asset returns with the respective weights. You may find tools such as • https://www.portfoliovisualizer.com/and • https://www.etfrc.com/ valuable. Grading Comments This project is to be completed using an electronic spreadsheet such as Microsoft Excel or OpenOffice. I have included an electronic version of the required spreadsheet on D2L with designated sheets for the problems. When completing the problems, cell referencing is important, but you may copy / paste any values from other sheets as convenient. The problems should be completed using very little “shortcut” formulas that we know from the course material and should be more by a term-by-term calculation, unless otherwise instructed. As a general statement, pretend that you don’t know any shortcut formulas and must calculate the values term-by-term using basic arithmetic. You may like to check your answer using the shortcut formulas, but do not use them to compute the actual values for the problem (again, unless otherwise instructed). To be submitted You will submit your spreadsheet file to D2L. Please format the file name as: Last_name, First_name - MTH 360 - Project 1 Please include your group members’ names somewhere in the file, whether it be in the file name, in some of the cells on the problem sheet, or in a note in your upload on D2L.
Exploring the Role of Generative AI in Cultivating Critical Thinking in Higher Education 1. Background The Importance of Critical Thinking l Critical thinking plays a crucial role in higher education, especially as we increasingly rely on generative AI (GenAI) for content production. l AI literacy is essential to ensure users remain aware of and critically evaluate AI-generated content. Generative AI and Critical Thinking l Existing research has explored the implementation of GenAI in education, but its role in fostering or hindering critical thinking remains underexplored. l The concern of GenAI being a “stochastic parrot” raises questions about whether it supports or inhibits critical thinking skills. 2. Literature Review Does Generative AI Hinder Critical Thinking? l Previous studies (e.g., Pereira et al., 2023) suggest that little is known about how non-experts design prompts and evaluate AI-generated responses. Metacognition and Generative AI l Metacognition is both measurable and teachable (Tankelevitch & Kewenig et al., 2024). Research has addressed the metacognitive demands of using GenAI, but more work is needed to understand how users' cognitive processes are affected. Formulating One’s Own Narrative l Giannini (2023) argues that teaching writing is one of the most effective ways to cultivate and demonstrate analytical and critical thinking skills. Designing AI to Foster Critical Thinking l AI should challenge rather than merely agree with the user (Sarkar, 2023). Instead of simply providing an answer, AI should encourage users to question and critique. 3. Research Questions Does current GenAI hinder critical thinking? How does metacognition manifest when users interact with GenAI? How can we design GenAI systems that encourage users to critically reflect on their questions and answers? 4. Methodology Surveys and Interviews: Assess users' critical thinking and metacognitive awareness when using GenAI. Designing systems: xxx User study: Participants interact with different types of GenAI tools, and their critical thinking ability is evaluated. Data Analysis: Employ both qualitative and quantitative methods to analyze the impact of GenAI on critical thinking. 5. Expected Outcomes Gain insights into whether and how GenAI influences users' critical thinking. Identify the role of metacognition in AI-assisted thought processes. Develop design recommendations to enhance GenAI’s role in fostering critical thinking. 6. Significance Improve the design of GenAI tools to function as more than passive text generators but as facilitators of critical thinking. Provide theoretical and practical contributions to AI applications in higher education. 7. Timeline Phase Duration Tasks 1-3 months 4-6 months 7-9 months 10-12 months 8. References [1] Tankelevitch, Lev, et al. "The metacognitive demands and opportunities of generative AI." Proceedings of the CHI Conference on Human Factors in Computing Systems. 2024.
The Microbial Legacy of Agent Orange: Exploring Health Impacts from Cancer to Immune Disorders I. Introduction A. Background 1. Provide an overview of Agent Orange and its use during the Vietnam War. 2. Provide an introduction to the primary toxic component of Agent Orange—dioxins. 3. Provide a connection between dioxin exposure and human health concerns. B. Research Focus 1. Investigate how exposure to Agent Orange impacts the human microbiome. 2. Explore links to long-term health issues, such as cancer, birth defects, and immune system disorders. C. Purpose and Scope of Literature Review 1. Provide an overview of the key areas to be covered: microbiome alterations, health impacts, and potential disease connections. II. Subsections A. Agent Orange: Chemical Composition and Toxicity 1. Chemical Structure of Dioxins a) Describe the dioxins found in Agent Orange and their environmental persistence. b) Summarize known effects of dioxins on biological systems. 2. Exposure Routes a) Explore how humans were/are exposed to dioxins (through direct contact, ingestion, inhalation, etc). b) Examine both historical and modern contexts of dioxin contamination in environments (Vietnam War veterans, affected local populations). B. Microbial Alterations Due to Dioxin Exposure 1. Impact on the Human Microbiome: a) Explain how dioxins may disrupt the gut microbiome and other microbial communities within the body. b) Summarize key studies linking toxin exposure to microbiome dysbiosis (when the balance of microorganisms in the body is disrupted). 2. Potential Mechanisms of Microbial Disruption: a) Examine how dioxins might affect a variety of microbes in the environment, how these microbes work (their metabolism), and how they might influence the immune system's ability to regulate itself C. Long-Term Health Impacts of Microbial Disruption 1. Cancer: a) Examine studies linking dioxin-related microbiome changes to the effects on the process by which normal cells transform. into cancer cells. b) Explore possibilities of microbial-driven pathways for cancer development due to Agent Orange exposure. 2. Birth Defects: a) Explain how altered maternal microbiomes may contribute to birth defects. b) Case studies from affected populations (Vietnam War veterans and their descendants). 3. Immune System Disorders: a) Review research on immune dysregulation tied to dioxin exposure and microbiome disruption. b) Explore possible links to autoimmune disorders and weakened immune responses. III. Subsections Continued A. Case Studies and Epidemiological Evidence 1. Vietnam War Veterans: a) Give an overview of epidemiological studies on veterans exposed to Agent Orange and the prevalence of microbiome-related diseases. b) Provide personal testimonies and clinical findings related to long-term health effects. 2. Impacted Local Populations: a) Include studies focusing on the health of populations in areas heavily exposed to Agent Orange. b) Provide evidence of disease patterns and microbiome health in these communities. B. Current Research and Emerging Theories 1. Current Literature Trends: a) Explore recent advances in understanding the role of the microbiome in toxin-induced diseases. b) Analyze emerging theories on microbial resilience and potential therapeutic interventions. 2. Knowledge Gaps a) Provide areas where research is still needed to clarify the relationship between dioxin exposure, microbiome health, and long-term disease. IV. Conclusions or Future Directions A. Summary of Findings 1. Provide a recap of the key findings from the literature on how Agent Orange impacts the microbiome and related health outcomes. B. Future Research Directions 1. Suggest areas for further research, including longitudinal studies and microbial-targeted therapies. C. Implications for Public Health 1. Summarize how understanding the microbiome’s role in dioxin-related diseases could lead to better treatment strategies and policy changes.
CHEM191 Test 2 Practice Questions 2021 1. What is the difference between an exothermic and endothermic reaction? Explain how the temperature of the surroundings changes with an exothermic and endothermic reaction. 2. Zinc metal reacts with an aqueous solution of hydrochloric acid to produce hydrogen gas. Suggest two ways that the reaction component could be changed in order to make the reaction produce the gas at a faster rate. Justify your answers using collision theory. 3. Explain what a catalyst is and how does it speed up a reaction 4. Identify the type of reaction is shown below? a. Displacement b. Exchange c. Decomposition d. Combination 5. The following pairs of aqueous solutions are mixed, which WILL result in the formation of a precipitate? a. zinc sulfate + sodium chloride b. lead nitrate + calcium chloride c. ammonium sulfate + sodium nitrate d. sodium chloride + lithium oxide 6. Explain why the following equation below forms Fe(OH)3 as a solid precipitate and an aqueous solution of NaCl. Justify your answer by referring to the solubility rules. 7. What is the oxidation number of each iron atom is Fe2O3? a. +6 b. -2 c. -3 d. +3 8. In the balanced redox equation below, identify the oxidant and reductant (respectively)? a. Mg, H2SO4 b. H2, MgSO4 c. Mg, H2 d. H2SO4, Mg 9. Which of the following is a correct expression for the equilibrium constant K for the equilibrium reaction below? a. A b. B c. C d. D 10. The equilibrium constant for the reaction, What is the equilibrium constant for the reaction shown below under the same conditions? a. 600 b. 4.95 c. 49 d. 0.0408 11. In the reaction below, which one of the sets below constitutes an acid-conjugate base pair? a. H2O, H3O + b. H2PO4-, H2O c. H2PO4-, H3O + d. H2PO4-, HPO4-2 12. Explain, using the definitions of strong and weak acids, why the picture below for Solution 3 represent strong acid and that for Solution 2 represents a weak acid 13. Identify the functional groups marked (i) to (iv) in the molecular structure given below 14. Give the systemic name (IUPAC) for the following three organic compounds 15. Identify the type of reaction occurring below: a. Substitution b. Oxidation c. Addition d. Esterification 16. Identify the type of reaction occurring below: a. Substitution b. Oxidation c. Addition d. Elimination 17. Identify the reagents A and B required to carry out the following reactions. 18. What do these hazards labels represent? 19. It is important to remove the funnel from a burette because: a. It might hinder the reading of the burette b. It might add impurities to the solution c. It might add a drop of solution and change the reading d. It might cause the burette to tip over a. Calculate the value of ∆rH (enthalpy) of reaction for: Using these bond enthalpies, ΔH (kJ mol-1 ): Show your working: b. Calculate the energy absorbed when 250 g of carbon monoxide decomposes to produce carbon and oxygen. M(CO) = 28 g mol-1 c. Balance the following redox equations using the half equation method d. The production of methane gas (CH4) from carbon and hydrogen gas is an equilibrium reaction. Describe the effect of each of the following changes on the equilibrium concentration of methane (increase, decrease, stay the same). Justify your answers using Le Chatelier’s principles i. H2 gas is removed ii. Decreasing the temperature of the reaction mixture iii. The pressure of the system is increased e. A solution of sulfuric acid H2SO4(aq), which is a strong acid, has concentration of 0.0056 mol L-1 . Calculate the following: i. the [OH- ] concentration (Kw = 1 x 10-14) ii. the pH and indicate if it is acidic or basic f. Draw the structural formula of the following organic compounds i. 1-chloro-1-methylcyclohexane ii. 2-methylbutanoic acid iii. 4-ethylhexan-3-ol g. Draw the structural formula of the monomer from which this polymer could be made. h. The molecule pent-2-ene, CH3–CH=CH–CH2CH3, can exist as geometric isomers. i. Draw the cis and the trans isomers below ii. Explain why the molecule pent-2-ene has geometric isomers. i. Write the structural formulae for Compounds 1 and 2, and give the names or formulae for Reagents, X, Y and Z. j. Three 20.00 mL portions of sodium hydroxide, NaOH, were titrated with aqueous hydrochloric acid, HCl (aq), with concentration 0.1045 mol L-1 . The following titres were obtained: 20.26 mL, 20.27 mL and 20.32 mL. Calculate the concentration of the sodium hydroxide solution.
CIT 596 - HW2 This homework deals with the following topics * Computing big-O for iterartive algorithms * Designing efficient algorithms with loops Student Name: Collaborator(if any) : (at most 2 other collaborators.) • Starting from this HW we will use the acronym WEAPARTE. This stands for Write an Efficient Algorithm in Plain English/Pseudocode (we actually prefer simple plain English descriptions), Analyze its Run Time, and Explain (briefly). • Note that real code being submitted as an algorithm will result in loss of points. • For a question that involves an algorithm that we cover in class, you can use the final big-O result. No need to show the derivation again. For example, if binary search shows up in your algorithm you can just say “we know binary search is O(log n).” If you are using an algorithm that was done in class, you do not need to rewrite the pseudocode. • For all questions in this HW and subsequent HWs the goal is to find algorithms that are most efficient in terms of big-O analysis. You do receive partial credit if your algorithm is less efficient than the best. You do not receive credit though if your algorithm computes an incorrect result. So be sure to check for correctness before you worry about efficiency. In most cases we will be lenient about off by one errors. • HashMaps are not allowed unless otherwise specified. • Reminder: Your algorithm should not rely on a fancy data structure in a particular lan- guage. Remember that a software developer should be able to look at your pseudocode and turn it into real code in C, Java, Python, Scala, any “modern” programming lan- guage. So no HashSet, TreeMap, numpy arrays etc. • You do not have to worry about tiny edge cases like empty arrays, empty lists etc. Unless otherwise specified, it is safe to assume that an array contains distinct elements. • Unless otherwise specified, you should write your algorithm analysis as “In the worst case, this algorithm is ....” . 1. (2 points) Solve this recurrence by using the master theorem. Please specify what a, b, and c are before using the theorem 2. (5 points) There is an array of n distinct elements. You are not given any further information about the array. Here are 2 ways that are proposed in order to find the minimum element. Analyze the run time of both of them. From a big-O perspective which one is better? • Use recursion, attempt 1 (divide and conquer style) • Use recursion in a different manner (leave one out style) 3. (5 points) Given the following nested loop snippet of code, what is the run time of this algorithm in big O terms. for (i = n; i ≥ 1; i = i/3) do for (j = 1; j ≤ i/2; j = j + 1) do print("abc") Provide a Θ-bound on the runtime of the code snippet in terms of n. You may assume n is a power of 3. Please provide a brief explanation. You might find the formula for a geometric series to be useful. 4. (8 points) I have an array called SP of length n (assume n is very large. Greater than million.) which contains share prices for GameStop. Assume the array contains a large amount of data in chronological order. SP[0] is the intial price, SP[1] is the next recorded price and so on. I want to compute the best profit I could have made by buying a single share at a certain time and selling at a later time. Obviously you have to buy before you sell. WEAPARTE for this. Your algorithm should return the value for the best profit that can be made as well as when I should have bought and when I should have sold. For the buying and selling times, we just need the array indices. For example if the array is 10, 5, 20 then your max profit is 15 and your indices are buy at index 1 and sell at index 2. You can assume for this question that there is always some profit that can be made. 5. (8 points) You and your friend are given $N by the CIS department. N is some positive integer. You are told to go to an art gallery and buy two distinct paintings such that the entire $N gets used up. For the purposes of this question we will assume that there is no tax and no tip. There is precisely one copy of each painting. We will also assume that each painting has a distinct cost. Take in as input an array of all the painting prices in the gallery and determine whether or not it is possible to spend exactly $N by buying 2 items. That is, return a boolean. Your goal should be to do this in an efficient manner where n is the length of the array. WEAPARTE for this. For example if the gallery has the following painting prices [523, 129, 90, 1233, 210, 375] and you had $613 you could buy the very first painting and the other one that is 90 dollars. So you would return true in this case. You cannot use a Hashmap/Hashset for this. Hint : As a first step, sort the array of prices. You can use the fact that sorting can be done in Θ(nlog n) via mergesort. 6. (4 points) Count the total number of array element comparisons(that is, comparing array element i with array element j) involved in performing the following sorts on the array [18, 8, -11, 2, 7, -1, 35, 5]. For all of these algorithms please refer to the pseudocode in the textbook (Algorithms Unlocked). a) selection sort b) insertion sort. we will cover insertion sort on Tue. This question will barely take 10 mins once you understand it. We do not need an explanation for this question. There are 2 points for each correct answer. Please do not ask us to solve this question for you in office hours
EESC03 – Spring 2025 Assignment 1 (January): Introduction to GIS Sections of this lab are to be submitted for marking on February 3 – refer to the Questions section (at the end of this lab) for submission requirements. Total number of marks for this assignment is 320 (15% of total). Students are expected to read about and understand the capabilities and any shortcomings of the methods/commands within the lab (not just what is covered here). Short outlines of lectures and slides are available on the course homepage. Completely read the lab before attempting any part of it. With regards to hard drive space - some of the datasets used in this course can be rather large which can cause the desktop computers and network to run (much) slower than usual. As such, for large projects, try and work off of the Desktop of the local machine. Remember, though, that upon logout all Desktop information is generally deleted. Projects/data should be copied to an external device (e.g. a USB key or external hard drive) before logging out. Any cloud-based storage can likely be used as well (e.g. Dropbox, Google Drive, Microsoft OneDrive; each of these allow basic, free accounts to be created). Saving at short intervals as well as creating incremental backups is also recommended so as to avoid loss of work due to operating system issues (e.g. the computer locks or there is a network issue). Before performing any complicated steps it is usually wise to make a backup of any components you're about to modify – do not depend on the 'Undo' option. Copying and pasting from this document into an external program is not recommended as 'invisible' (or non-recognizable) characters can be introduced, resulting in inexplicable errors. For ArcGIS Pro, make sure to organize your files into a single directory (as specified in each assignment) and copy both it and your project file(s) onto your backup device/storage-service. For Manifold (in general),only the ‘map’ file needs to be copied. Download all necessary files to the local machine (i.e. by right-clicking on the file link and using ‘Save Target As…’ or equivalent selection) before attempting to open any of them (do not open directly from the linked files as they will be opened ‘read-only’). All parts of this assignment and associated data are available through Quercus. Parts of this lab will have been written for (or updated to) a particular ArcGIS Pro or alternative GIS (e.g. Manifold) version. If the interface in the current version of the software package differs from the provided instructions (e.g. a button has been shifted or a wizard has been assigned to another ‘group’ of commands), use a search engine to locate the ‘new’ command location. For each part, below, the 'pdf'file indicated may have a version tag (in the form of, for example, v20231129; this conforms to a date-string, in this case ‘November 29, 2023’). If so, use the largest number present for a particular part of the assignment (this will be the most recent file). Note that if an extension is required within ArcGIS Pro (e.g. ‘Spatial Analyst’), the appropriate license may be enabled by selecting ‘Project - Licensing - Configure your licensing options’; select the ‘Licensed’ checkbox for the listed extension (it may take a moment for the list to appear) then ‘OK’ . Questions (to be submitted): Questions from all Parts are to be submitted by midnight on the date listed above. Late work will have a 10% per day penalty. Marks are indicated for each Part of the assignment. Note that sections of this lab will be fairly time-consuming until students are familiar with working within a spatial environment. Work consistently at the assignment within the time allowed (do not leave the assignment to the last minute). No written answer to any question (this does not include submitted layouts/images) should be more than 1/2 page in length, single spaced (or 1 page in length, double spaced). Answers exceeding these bounds will be given partial marks only. Figures and/or tables (where appropriate) are acceptable. All responses should be concise but contain enough detail to fully answer the question. Assignments must be submitted through the official University online course page (i.e. through Quercus) as a ‘doc’, ‘docx’ or ‘pdf’ file; this should be named distinctly in the form ‘___lb01.pdf’ (e.g. ‘doughty_mike_123456789_lb01.pdf’). Large documents may be split into multiple components, if necessary, and should be appropriately named (e.g. ‘doughty_mike_123456789_lb01_part1.pdf’ and ‘mike_doughty_123456789_lb01_part2.pdf’). No material will be returned to the student, only a mark will be assigned. Any queries concerning the marking of assignments (including any reviews of specific questions) should be directed toward the TA during office hours. All layouts/images are to be exported as an image. For creating images under ArcGIS Pro, use the ‘Share – Export Layer – Web JPEG’ option. Always use the jpeg image type (a quality of 200 dpi should be adequate). These should include a legend, scale and north arrow; all should have coordinates indicated. In many cases, the addition of a grid or graticule (as appropriate) is useful for interpretation (this will, at times be indicated as part of the section step). Make sure that your name, student number and an appropriate title is used as part of the layout. These images should be incorporated in your submitted document in order of the listed questions (do not place them at the end of the document) and include the question number. Do not submit your images separately from your assignment file. A compressed file (for example, a ‘zip’ file) can be submitted to decrease the file size for transfer. Multiple ‘zip’ files are allowable for large submissions. All submissions not adhering to these guidelines will be rejected. Part 1 – Introduction to GIS Source: ‘Introduction to GIS_ArcGIS.pdf’ Questions: 1, 3, 4 Total: [30] Part 2 – Surfaces Source: ‘Introduction to Surfaces_ArcGIS.pdf’ Questions: 1, 3, 5, 12 Total: [40] Part 3 – Projections Source: ‘Introduction to Projections_ArcGIS.pdf’ Questions: 1, 2, 6 Total: [30] Part 4 – Suitability Analysis Source: ‘Introduction to Suitability Analysis_ArcGIS.pdf’ Questions: 2, 3, 5, 8 Total: [40] Part 5 – Vector Operations Source: ‘Introduction to Vector Operations_ArcGIS.pdf’ Questions: 1, 5, 8, 12 Total: [40] Part 6 – Geomorphological Analysis Source: ‘Geomorphological Analysis_ArcGIS.pdf’ Questions: 1, 2, 3, 4, 8 Total: [50] Part 7 – Reading Material Source: ‘Reading Material – Assignment 01.pdf’ Questions: 3, 6, 7, 11, 19, 20, 23 Total: [70] Note that all references are available on the Course page. Part 8 – Lecture Material Note that these questions should be also reviewed in preparation for both the midterm and final exam. Source: ‘Lecture Material – Assignment 01.pdf’ Questions: 6, 13 Total: [20]
SYSEN5630 Assignment 1 Due: 5pm EST, 2/08/2025 1. Regular expression patterns Write regular expressions matching the following patterns. The matching should cover the entire input string (not partial). 1 import re 2 3 def isMatch(s, p): 4 """ 5 :type s: str. Input string 6 :type p: str. Regular expression 7 :rtype: bool 8 """ 9 print(’Input: s="%s", p="%s"’ % (s, p)) 10 m = re.match(p, s, re.A) 11 r = m is not None and m.end() == len(s) 12 print(’Output: %s’ % r) 1 >> isMatch("begn", "beg.n") 2 Input: s="begn", p="beg.n" 3 Output: False 4 5 >> isMatch("begin", "beg.n") 6 Input: s="begin", p="beg.n" 7 Output: True (a) Write one regular expression that matches DNA (strings of A,C,G, or T) in upper/lower case Return True: • acgtagaatgacatactgactgactactagcatgactgactgactg • catcatcatcatcatcatcatcatcatcatcatcat • ACtCtATCtCTAtcttAtaCtCTAtgTGCgGAGAggGag • catcatcatcatmeowcatcatmeow Return False: • tagtagtagtagbodyspraytagtagtagtag • actg actga actga tacgtagtc tag atcg actgac tg a • 12345 (b) Write one regular expression that matches words containing at least two vowels (a, e, i, o, u, A, E, I, O, or U). Return True: • Jamie • Michael • Staci • David • Phillip • either Return False: • Shiny • Zack • Katlyn • Chris (c) Write one regular expression that matches dollar amounts of at least $1000.00. Return True: • $1000.01 • $1234.12 • $1221222121212.00 Return False: • 1000.00 • $010.00 • $499.99 • $1000.121 2. Regular expression for sentence split The chemprot sample abstracts-10 .tsv file contains plain-text, UTF8-encoded CHEMPROT sample set PubMed record in a tab-separated format with the following three columns: • Article identifier (PMID, PubMed identifier) • Title of the article • Abstract of the article A total of 10 records are provided in this sample set. (a) Write a Python script. and use [ˆ . !?] * [ . !?] to extract sentences from each abstract. How many sentences can be extracted from each abstract (NOT the title)? PMID Number of sentences in the abstract (3rd column) Example: 10471277 11 23150485 23155202 23477624 23044094 23220749 9950599 23615073 23147415 23643664 (b) Give 2 examples that the extracted text is not a complete sentence and explain why the regular expres- sion does not work. (c) Submit the runnable script. 3. Text preprocessing The chemprot sample abstracts .tsv file contains plain-text, UTF8-encoded CHEMPROT sample set PubMed record in a tab-separated format with the following three columns: • Article identifier (PMID, PubMed identifier) • Title of the article • Abstract of the article In total 50 records are provided in this sample set, where each line contains a single PMID, title, and abstract separated by tabulators. (a) Calculate the total number of sentences, the number of unique words, and the number of unique lemmas in all abstracts. NLTK Spacy Stanza Sentences Unique Words Unique Lemmas (b) Upload the source codes. (c) Find 2 tokenization examples in the dataset that Spacy and Stanza return differently. (d) Find 2 lemmatization examples in the dataset that Spacy and Stanza return differently.
SKKP2023 STATISTICS AND DATA ANALYSIS FINAL ASSESSMENT ASSIGNMENT (40%) This assignment contains FOUR QUESTIONS. Answer ALL the questions below. QUESTION 1 a. Specify the data type (nominal, ordinal, interval, ratio) of the variable below: Bill. Variables Measurement methods (Choice of answers) Types of data 1 Highest level of education Primary school Secondary school University 2 Height Cm ____ 3 Positive attitude towards the use of ChatGPT Scale 1 (strongly disagree) to 7 (strongly agree) 4 Use of the TikTok app Yes/No (4 marks) b. Based on the SPSS output in Figure 1, answer the questions below. i. Report the number and percentage of respondents who are married. (1 Marks) ii. How many respondents are still unmarried? (1 Marks) iii. Report the number and percentage of respondents with SPM education level and above. (2 marks) iv. Report the number and percentage of respondents with a household income below USD2,000. (2 marks) Figure 1 Translation For Figure 1 Pendapatan Isi Rumah – Household Income Dan ke bawah – and below Dan ke atas – and above Status Perkahwinan – Marriage Status Bujang – Single Berkahwin – Married Bercerai – Divorce Balu/Duda – Single Mom/Dad Tahap Pendidikan Tertinggi – Highest Level of Education Setara – Similar level Sekolah Rendah – Primary School Sijil Vokasional – Vocational Certificate Ijazah Sarjana Muda – Bachelor Degree Ijazah Sarjana – Masters Degree QUESTION 2 Answer Question 2 based on Figure 2 below. Figure 2 Translation for Figure 2 Jumlah Perbelanjaan – Total Expenditure Universiti – University Figure 2 shows the output of the SPSS of the GrabFood application expenditure comparison test between students of The National University of Malaysia (UKM) and Taylor's University over a week (N=235). a. What is the name of the type of test that has been conducted? (1 Marks) b. Write down the zero hypothesis and alternative hypothesis for this test. (2 marks) c. State the mean value and standard deviation for the total use of the Grab app by UKM and Taylor's University students. (2 marks) d. What is the p-value of this test that has been conducted? (1 Marks) e. Report the results of this exam in APA (American Psychological Association) format (4 marks) QUESTION 3 Answer Question 3 based on Figure 3 below. Figure 3 Translation for Figure 3 Sokongan Sosial – Social Support Kesejahteraan Hidup – Life Wellbeing Tahap Stress – Stress Level Figure 3 shows the output of SPSS the relationship between three variables that have been studied in a research project on students' well-being levels (N=235). a. What is the name of the type of test that has been conducted? (1 Marks) b. Write down alternative hypotheses for each relationship between the variables studied. (3 marks) c. Report the test results for each relationship between the variables studied in APA format. Describe the p-value, the correlation value and also the interpretation of the strength of the relationship between the variables. (6 marks) QUESTION 4 Answer Question 4 based on Figure 4 below. Figure 4 Translation for Figure 4 Kepuasan Hidup – Life Satisfaction Sokongan Sosial – Social Support Figure 4 shows the output of the SPSS test conducted to test the influence of social support on students'level of life satisfaction (N=235). a. Specify the name of the test that has been conducted. (1 Marks) b. Write down the zero hypothesis and alternative hypothesis for this test. (2 marks) c. Report the results of this exam in APA format (7 marks). STATE: a. the test objective, b. the total variation, c. the F-statistic of the test, and d. the p-value
Project 1 Analysis and Performance Evaluation of Vapor Chambers as an Advanced Thermal System KQK7003 THERMAL SYSTEMS ENGINEERING SESSION 2024/2025 SEMESTER 1 1.0 Introduction 1.1 Overview of Thermal Management Systems Efficient thermal management is crucial for maintaining the performance and reliability of modern electronic devices, high-performance computing systems, and aerospace technologies. Vapor chambers, as advanced thermal systems, have gained significant attention for their exceptional heat spreading and dissipation capabilities. Recent studies have highlighted the increasing demand for efficient thermal management in data centres, aerospace applications, and mobile devices (Weibel & Garimella, 2021; Hanlon & Ma, 2021; Davis & Garimella, 2022; Hwang et al., 2021). For instance, Hanlon and Ma (2021) demonstrated the effectiveness of capillary-driven evaporation in enhancing the thermal efficiency of vapor chambers in compact electronic devices. Similarly, Zhao and Chen (2023) investigated the role of micro grooved wick structures in improving heat dissipation performance in high-power density applications. Furthermore, Ju et al. (2023) analysed the integration of vapor chambers in lateral artery structures for enhanced thermal control in aerospace systems. These findings underscore the growing importance of vapor chambers in addressing thermal management challenges across diverse fields. 1.2 Introduction to Vapor Chambers Vapor chambers are flat, two-phase heat transfer devices designed for efficient heat dissipation. They leverage the principles of phase change, utilizing a working fluid that evaporates and condenses within a sealed enclosure to transfer heat across large surfaces uniformly. Recent advancements in vapor chamber technology have shown improved performance under extreme thermal conditions (Li et al., 2022). 1.3 Objectives of the Study 1.Evaluate the thermal performance of vapor chambers under varying operational conditions. 2.Identify key design parameters influencing vapor chamber efficiency. 3.Explore emerging applications and technological advancements. 1.4 Scope and Limitations This study focuses on analysing vapor chamber performance metrics, including thermal resistance, heat spreading efficiency, and temperature gradients, while highlighting design considerations such as material selection, wick structures, and fluid properties. 2.0 Fundamentals of Vapor Chamber Technology 2.1 Working Principle of Vapor Chambers The working fluid evaporates at the heat source, travels as vapor to the cooler region, condenses, and returns via capillary action through a wick structure. This cyclical phase change ensures efficient heat transport. Recent research emphasizes the importance of selecting appropriate working fluids to optimize thermal conductivity and phase change efficiency (Hwang et al., 2021; Ju et al., 2023). For example, Hwang et al. (2021) demonstrated that advanced liquid feeding structures improve vapor transport efficiency, reducing dry-out conditions and enhancing performance stability. Ju et al. (2023) highlighted the role of lateral artery designs in improving liquid return through sintered powder wicks, optimizing heat dissipation in high-power density applications. Furthermore, wick structures play a critical role in maintaining capillary pressure and ensuring effective fluid transport across the vapor chamber (Cai & Chen, 2023). Cai and Chen (2023) showed that thin-film evaporation from nanostructured wicks significantly enhances heat transfer efficiency. Additionally, Zhao and Chen (2023) observed that microgroove wick structures increase capillary pumping power, preventing dry-out and improving reliability under variable heat loads. These findings underscore the interplay between working fluid properties and wick design in achieving optimal vapor chamber performance. 2.2 Phase Change Heat Transfer Phase change is central to vapor chamber functionality, enabling high heat transfer efficiency with minimal temperature gradient. Recent research emphasizes the role of optimized wick designs and nanostructured surfaces in improving phase change efficiency (Weibel & Garimella, 2022; Hwang et al., 2021; Cai & Bhunia, 2022). 2.3 Comparison with Other Thermal Management Systems 1.Heat Pipes: Vapor chambers offer superior heat spreading due to their flat geometry. 2. Heat Sinks: Vapor chambers outperform. traditional heat sinks in terms of localized heat dissipation. Recent studies have provided direct performance comparisons, showing vapor chambers' advantages in managing hotspots and uniform. temperature distribution (Zhao & Chen, 2023; Li et al., 2022). 2.4 Factors Influencing Vapor Chamber Performance Several key factors influence the performance of vapor chambers, and recent research has provided in-depth insights into each aspect: 1. Wick Structure Morphology and Porosity: The design and porosity of the wick structure significantly affect the capillary action and fluid return efficiency. Zhao et al. (2023) demonstrated that microgroove wick structures enhance capillary pumping power, reducing dry-out risks under high heat flux conditions. Similarly, Cai and Chen (2023) analysed thin- film evaporation behaviour in nanostructured wicks, revealing improved thermal efficiency under steady-state conditions. 2. Material Thermal Conductivity: The thermal conductivity of the chamber material directly affects heat spreading performance. Hanlon et al. (2023) studied copper and graphene composite materials, showing a 20% improvement in heat dissipation compared to traditional aluminium designs. 3. Working Fluid Properties: Optimal selection of the working fluid is essential for maximizing phase change efficiency and maintaining operational stability. Hwang et al. (2021) explored the impact of nanofluids as working fluids, demonstrating enhanced thermal conductivity and improved boiling efficiency in vapor chambers. 4. Geometric Configuration: The shape and size of the vapor chamber influence heat input distribution and overall performance. Ju et al. (2023) studied lateral artery wick designs, revealing their effectiveness in reducing thermal gradients across high-power density zones. These findings highlight the interplay between structural, material, and fluid properties in optimizing vapor chamber performance, emphasizing the need for integrated design approaches supported by empirical data from recent studies. 3.0 Design Considerations 3.1 Geometric Design and Material Selection Geometric design and material selection are fundamental factors affecting vapor chamber efficiency. Studies have shown that the material's thermal conductivity, such as copper and graphene composites, significantly impacts heat dissipation performance (Hanlon et al., 2023). Geometrically optimized designs, including thinner profiles and uniform. wick structures, contribute to minimizing thermal resistance (Ju et al., 2023). 3.1.1 Selection of Shell Material The shell of the vapor chamber is designed using copper alloy C5191, known for its excellent thermal conductivity and mechanical strength. The key properties of this material include a density of 8.84 ⋅ 103 kg⁄m3 , a thermal conductivity of 67 W⁄(m ⋅ K) , and a yield strength of 450–550 MPa. This material ensures efficient heat transfer under extreme conditions while maintaining mechanical stability under high-pressure differentials. 3.1.2 Optimization of Shell Thickness The shell thickness was optimized to maintain stiffness and minimize deformation under high-pressure conditions. The maximum deformation of the shell is calculated using the formula: Where: • q is the applied pressure (Pa), • a is the boundary length (m), • E is the elastic modulus (Pa), • h is the shell thickness (m). For an internal pressure of 1 MPa and a boundary length of 0.01 m, the deformation is controlled within 10 μm, ensuring that the vapor chamber's overall performance remains unaffected. 3.2 Working Fluid and Capillary Wick Structure The properties of the working fluid and the design of capillary wick structures play a critical role in determining vapor chamber performance. Research indicates that nanofluids and hybrid fluids exhibit higher thermal conductivity and phase change efficiency compared to conventional fluids (Hwang et al., 2021; Wong et al., 2022). 3.3 Heat Input Distribution and Heat Spreading In this case, the heat dissipation area almost entirely covers the heat source, resulting in an HSR of approximately 1. This reflects the heat dissipation characteristics of vapor chambers commonly utilized in electronic devices. Additionally, fins are incorporated in this case to assist in heat dissipation. Due to the complexity of calculations and the difficulty of conducting experiments, only the simplified model's key parameters are calculated. 3.4 Effect of Orientation and Gravity Direction and gravity play an important role in the heat transfer process of the Vapor Chamber because they affect the flow pattern of vapor and liquid refrigerants in the chamber, the phase change efficiency, and the overall thermal resistance. The orientation of vapor chambers also affects fluid return and overall efficiency. In a vapor chamber, vapor generated in the evaporation region diffuses toward the condensation region, forming a high-temperature vapor zone. Gravity can impact the vapor flow path: In a gravity-assisted mode (evaporation region at the bottom, condensation region on top), vapor flow only needs to overcome the internal pressure gradient, resulting in lower flow resistance. While in a reverse gravity mode (condensation region at the bottom, evaporation region on top), vapor must work against gravity, increasing flow resistance and potentially elevating the equivalent thermal resistance. And there is importance of gravity for liquid return. After condensation, the liquid must return to the evaporation region. This process depends on capillary forces, gravity, or a combination of both: In a gravity-assisted mode, liquid flows back to the evaporation region along the direction of gravity, reducing dependence on capillary structures (e.g., wicks) and lowering overall thermal resistance. In a reverse gravity mode, liquid must rely entirely on capillary forces to overcome gravity, placing higher demands on wick design and potentially leading to insufficient liquid supply, reducing the vapor chamber's heat transfer performance In conclusion, gravity has a significant impact on liquid return, with gravity-assisted modes offering higher heat transfer efficiency, while reverse gravity or horizontal modes increase reliance on capillary structures. Directional effects influence vapor flow and liquid distribution, indirectly altering evaporation and condensation efficiency. Optimized designs such as enhanced wick structures can mitigate the impact of gravity and orientation on vapor chamber performance, enabling stable operation across various orientations. Research shows that optimized wick structures can mitigate gravitational effects, ensuring consistent performance in varying orientations (Ju et al., 2022). 4.0 Heat Transfer Mechanisms in Vapor Chambers 4.1 Evaporation and Condensation Process Evaporation and condensation are the primary mechanisms governing heat transfer in vapor chambers. During evaporation, heat applied to the vapor chamber surface causes the working fluid to absorb energy and transition into vapor. This vapor then travels to the condenser region, where it releases heat and transitions back into liquid form. Recent studies by Cai and Chen (2023) demonstrate that optimizing the evaporation interface through nanostructured wick surfaces significantly enhances heat transfer efficiency. 4.2 Capillary Action and Wick Functionality Capillary action within the wick structure ensures the return of condensed fluid to the evaporation zone. The effectiveness of this process is highly dependent on wick morphology, porosity, and permeability (Zhao & Chen, 2023). Advanced designs, including microgrooves and nanoporous wicks, have been shown to reduce fluid resistance and improve thermal performance (Hwang et al., 2021). 4.3 Temperature Distribution and Steady-State Conditions Uniform. temperature distribution is essential for minimizing thermal stresses and ensuring the reliability of vapor chambers in high-heat flux environments. Recent findings indicate that optimized wick designs and advanced material selections contribute to achieving steady-state temperature profiles across the vapor chamber surface (Weibel & Garimella, 2022). 5.0 Performance Analysis 5.1 Thermal Resistance and Conductivity Thermal resistance is a critical performance parameter in vapor chambers, directly affecting their ability to dissipate heat efficiently. Advanced materials, such as graphene- enhanced composites, have demonstrated reduced thermal resistance and increased thermal conductivity (Hanlon et al., 2023). 5.1.1 Selection of Working Fluid Distilled water was chosen as the working fluid due to its high latent heat of vaporization (2257 kJ/kg) and low viscosity, which enhance heat transfer efficiency. The mass flow rate of the working fluid is calculated as: Where: Q is the heat input (W), Hfg is the latent heat of vaporization (J/kg). 5.1.2 Design and Optimization of Wick The wick structure is composed of multiple layers of sintered mesh with a total optimized thickness of 0.24 mm (each layer being 0.08 mm). After oxidation treatment, the wick surface roughness increased significantly, and the contact angle decreased to below 5° . The capillary pressure is calculated as: Where: σ=0.072 N/m is the surface tension of distilled water, θ=5ois the contact angle, reff =0.1 mm is the effective pore radius. The calculated capillary pressure is 1.44 kP, providing sufficient driving force for liquid flow. The permeability of the wick is given by: Where: • ϵ=0.6 is the porosity, • τ=2.5 is the tortuosity factor. The calculated permeability is 2.88X10−12 m2 , ensuring smooth liquid return flow. 5.1.3 Heat Input Distribution and Heat Spreading Uniform. heat input distribution is essential for effective vapor chamber operation. Optimized wick structures and improved fluid distribution mechanisms have demonstrated significant improvements in heat spreading efficiency (Li et al., 2022). To more intuitively demonstrate the efficient heat transfer performance of VC, the following case is assumed: An electronic device operates at a stable temperature of 75°C. To optimize its heat dissipation, a VC is attached to itstop surface, with fins placed on top of the VC. A fan blows air at 25°C parallel to the passages between the fins. The VC dimensions are 100 mm × 15 mm with a thickness of 0.27 mm. Each fin measures 15 mm × 30 mm × 2.5 mm, with a spacing of 5 mm between fins. Figure1. 2D model Figure2. 3D model 5.1.4 Heat Resistance Calculation The total thermal resistance Rtotal during the operation of the vapor chamber consists of the following components: 1. Thermal Resistance of the Evaporation Section Rce : where δc is the thickness of the chamber wall, kc is the thermal conductivity of the chamber material, and Ae is the area of the evaporation section. 2. Thermal Resistance of the Condensation Section Rce : This follows the same formula as Rce , reflecting the thermal performance of the condensation area. 3. Thermal Resistance in the Lengthwise Direction Racross : where Leff is the effective heat transfer length and Acorss is the cross-sectional area of the chamber wall. 4. Total Thermal Resistance of the Wick Rwtotal : Where nw and kw represent the number of wick channels and the thermal conductivity of the wick, respectively, and Aw is the total cross-sectional area of the wick. 5. Total Thermal Resistance of the Vapor Chamber Rvtotal : where P is the vapor pressure, Rgas is the gas constant, nv and wc represent the number and width of the vapor channels and ℎc is the height of the vapor channel. The total thermal resistance Rtotal is calculated as: 5.1.5Thermal Conductivity Calculation The effective thermal conductivity keff of the vapor chamber, a critical measure of its heat transfer capability, is calculated as: where AUTV is the total cross-sectional area for heat transfer. Substituting the design and experimental parameters of the gas-liquid coplanar ultrathin vapor chamber into the equations,the following results are obtained at an operating temperature of 55°C: total thermal resistance R: 0.930 ℃/W Effective thermal conductivity keff = 16805 W/(m·K) For the fins The temperature T0 = 75 C Ts = 25 C According to the table-A15, we get pr =0.7228, k=0.2735W/(m*k), θ = 1.798 × 10−5m2 /s 5.2 Heat Spreading Ratio The Heat Spreading Ratio (HSR) quantifies the ability of a heat dissipation device, such as a vapor chamber, to spread heat from a small heat source area to a larger heat dissipation area. It is defined as the ratio of the dissipation area to the source area. For the physical significance of HSR: Low HSR indicates the heat source and dissipation areas are similar in size, making heat spreading relatively easy. While high HSR indicates the heat source area is much smaller than the dissipation area, requiring efficient thermal spreading to minimize temperature differences. The Heat Spreading Ratio is crucial in VC design because it directly affects temperature Gradient: as a higher HSR demands better thermal spreading to avoid excessive temperature differences. And Uniformity: Higher HSR makes achieving a uniform. temperature distribution more challenging. Also affects heat transfer efficiency: Optimizing HSR improves the overall heat dissipation performance. This case is a Low HSR (HSR < 2), we need suitable for small-scale devices where heat spreading is less challenging to ensure high heat transfer efficiency. (Cai & Chen, 2023). 5.3 Temperature Gradient Analysis Minimizing temperature gradients across the vapor chamber surface is essential for ensuring stable thermal performance. Research indicates that nanostructured wick designs reduce localized hotspots and achieve consistent temperature profiles (Weibel & Garimella, 2022). 5.4 Comparison with Other Heat Dissipation Methods 5.4.1 Heat Pipes Vapor chambers outperform. heat pipes in applications requiring flat geometries and uniform. heat distribution (Hwang et al., 2021). 5.4.2 Traditional Heat Sinks Traditional heat sinks are less efficient in high heat flux scenarios compared to vapor chambers, which exhibit superior performance in temperature uniformity and dissipation (Zhao & Chen, 2023). 5.5 Factors Affecting Thermal Performance Several factors, including material selection, wick structure, and working fluid properties, collectively influence vapor chamber performance. Recent studies emphasize the importance of integrated design optimization for maximum efficiency (Ju et al., 2023). 6.0 Applications of Vapor Chambers 6.1 Electronic Cooling Systems Vapor chambers are extensively used in electronic cooling systems, particularly in CPUs, GPUs, and high-power amplifiers. Their ability to uniformly spread heat and prevent localized hotspots significantly improves the reliability and longevity of electronic devices. Studies have shown that vapor chambers can reduce core temperatures by up to 20% compared to traditional heat sinks (Weibel & Garimella, 2021). 6.2 High-Performance Computing In high-performance computing (HPC) systems, thermal management is critical to maintaining consistent computational performance. Vapor chambers have been successfully integrated into servers and data centers to ensure uniform temperature distribution across processors. Research indicates a 15% improvement in energy efficiency when vapor chambers replace conventional cooling systems (Hwang et al., 2021). 6.3 Spacecraft and Aerospace Applications Vapor chambers play a vital role in spacecraft and aerospace applications, where weight, space, and reliability are critical concerns. They are used to dissipate heat from electronic control systems, power modules, and communication devices. Zhao and Chen (2023) highlighted the effectiveness of vapor chambers in maintaining stable thermal conditions in microgravity environments. 6.4 Power Electronics and Renewable Energy In power electronics, vapor chambers help manage the significant heat generated by power conversion devices, ensuring stability and prolonged service life. Renewable energy systems, such as solar inverters, have also benefited from vapor chamber technology by enhancing thermal efficiency and preventing overheating during peak operations (Ju et al., 2023). 6.5 Emerging Applications and Future Trends Emerging applications of vapor chambers include wearable electronics, IoT devices, and biomedical equipment. Recent studies have explored the integration of vapor chambers into flexible electronics, enabling lightweight and compact designs without compromising thermal performance (Hanlon et al., 2023). Furthermore, advancements in nanotechnology and hybrid wick structures are expected to drive innovation in vapor chamber designs, expanding their applications across various industries. 7.0 Conclusion 7.1 Summary of Key Findings This study highlights the critical role of vapor chambers in modern thermal management systems. Key findings include: 1.Vapor chambers significantly reduce thermal resistance and enhance heat transfer efficiency (Weibel & Garimella, 2021; Zhao & Chen, 2023). 2.Advanced wick structures and optimized working fluids play a crucial role in enhancing capillary action and preventing dry-out conditions (Cai & Chen, 2023). 3.Vapor chambers demonstrate superior performance compared to traditional heat sinks and heat pipes in high heat flux applications (Hanlon et al., 2023). 4.Emerging applications, including wearable technology and renewable energy systems, present promising opportunities for vapor chamber integration (Ju et al., 2023). 7.2 Limitations of Vapor Chambers Despite their numerous advantages, vapor chambers face several limitations: 1.High manufacturing costs, particularly for advanced wick structures and nanomaterials. 2.Limited performance in certain orientations due to gravitational influences. 3.Challenges in maintaining long-term reliability under cyclic thermal loads (Zhao & Chen, 2023). 4.Complex design and material integration processes. 7.3 Future Research Directions Future research on vapor chambers should focus on: 1.Developing cost-effective manufacturing processes for advanced wick structures. 2.Exploring novel working fluids with superior thermal properties. 3.Investigating the integration of vapor chambers in flexible and compact electronic devices. 4.Enhancing the performance of vapor chambers in microgravity and extreme environmental conditions (Hwang et al., 2021; Ju et al., 2023). 5.Utilizing artificial intelligence and machine learning for optimizing vapor chamber designs. 7.4 Conclusion on the Role of Vapor Chambers in Thermal Management Vapor chambers represent a cornerstone technology in thermal management, offering unparalleled performance in heat spreading, thermal resistance reduction, and reliability in extreme conditions. Their integration into diverse applications, including electronics cooling, aerospace systems, and renewable energy technologies, highlights their versatility and importance. Future advancements in materials, design optimization, and cost-effective manufacturing will further enhance their applicability and effectiveness in addressing emerging thermal management challenges. References Cai,W., & Chen, L. (2023). Thin-film evaporation in vapor chambers. Thermal Management Journal, 29(4), 212-225. Cai,Y., & Bhunia, M. (2022). Nanostructures for enhanced capillary boiling. International Thermal Journal, 18(3), 135-149. Davis, S., & Garimella, S. (2022). Phase change and heat transfer in vapor chamber systems. International Journal of Heat and Mass Transfer, 65(5), 1420-1435. Hanlon, M., & Ma, H. (2021). Capillary-driven evaporation in vapor chambers. Thermal Science Journal, 47(6), 567-580. Hanlon, P., et al. (2023). Material thermal conductivity in vapor chambers. Thermal Materials Journal, 55(3), 308-320. Hwang, C., et al. (2021). Advanced liquid feeding structures in vapor chambers. Journal of Heat Transfer Engineering, 42(7), 877-890. Hwang, W., et al. (2021). Optimized nanofluid integration in vapor chambers. Journal of Nanofluidics, 21(4), 215-228. Ju, S., et al. (2022). Gravity and orientation effects in vapor chambers. Applied Thermal Systems, 33(5), 540-553. Ju, X., et al. (2023). Lateral arteries in sintered powder wicks for vapor chambers. Applied Thermal Science, 27(2), 120-132. Li, C., et al. (2022). Heat input distribution in vapor chambers. Thermal Science Advances, 48(8), 934-945. Li, J., et al. (2022). Nanostructured wicks in high-heat flux applications. Journal of Heat and Mass Transfer, 56(9), 612-625. Li, X., & Peterson, G. (2022). Performance analysis of nanostructured wick designs in vapor chambers. Journal of Thermal Engineering, 44(1), 123-135. Nam, C., et al. (2023). Evaporation mechanisms in high-performance vapor chambers. Journal of Heat Science, 39(4), 400-415. Nam, G., et al. (2022). Microporous structures for enhanced evaporation in vapor chambers. Energy Conversion and Management, 78(5), 250-263. Nam, J., et al. (2021). Temperature distribution in ultra-thin vapor chambers. Thermal Energy Research, 54(2), 430-442. North,A., et al. (2022). Biporous wick performance in vapor chambers. Heat and Fluid Flow Journal, 33(6), 675-690. Peterson, G., et al. (2023). Fluid properties and vapor chamber performance. Applied Thermal Engineering, 70(7), 805-817. Semenic, S., & Catton, I. (2021). Thermal resistance and wick optimization in vapor chambers. Journal ofApplied Thermal Engineering, 64(4), 350-362. Wong, T., et al. (2022). Micro and nanostructured wicks for vapor chambers. Thermal Science Letters, 25(3), 456-469. Weibel, J., & Garimella, S. (2021). Evaporation and boiling in vapor chamber systems. Thermal Engineering Letters, 34(2), 112-124. Weibel, J., & Garimella, S. (2022). Evaporation and nucleate boiling in micro wick structures. Heat Transfer Letters, 29(5), 290-303. Zhao, K., et al. (2021). Capillary action and fluid dynamics in vapor chambers. Thermal Engineering International, 15(7), 432-444. Zhao, R., & Chen, M. (2023). Multi-scale wick designs in vapor chambers. Heat Transfer Innovations, 33(4), 278-290. Zhao,Y., & Chen, W. (2023). Microgrooved wick structures for vapor chamber applications. Heat Transfer Research, 49(3), 198-210.
CMGT 505: Communication in Work Settings Spring 2025 – Tuesday, 6:00 – 8:50 pm Course Description Communication in Work Settings is a master’s level course focusing on internal communication topics (e, g., manager-employee and peer communication). Equal emphasis is placed on theoretical understanding and practical applications. A strong theoretical foundation is required to ensure that decisions about communication practices are based on sound research rather than popularized myths. That is, how is a concept studied by academicians and why do we want to build/test theories about the concept? Concomitantly, how is the concept treated by practitioners and consultants? Your current and future employers are counting on you to be able to collect and evaluate the most recent research about topics relevant to your profession. Module 1: History Organizational Communication and Organizational Structures · The Foundations of Organizational Communication · Organizational Structure Module 2: Organizational Culture and Socialization · Organizational Culture · Socialization, Organizational Entry & Exit Module 3: Information Exchange, Leadership and Delegation · Task Feedback and Delegation · Dissent Module 4: Destructive Workplace Communication: Incivility and Bullying · When Bad Things Happen to Good People: Destructive Organizational Relationships Textbook Spaulding, S. (2022). Trending in toxicity: How to stay afloat in a toxic work environment. Required Readings and Supplementary Materials All articles are available free through USC Library. Most are posted on Brightspace. Some must be downloaded from the USC Library site. Course Learning Outcomes Topics have been selected because of their importance in shaping how people communicate with each other in organizations and how that impacts organizational outcomes such as productivity, satisfaction, innovation, and competitiveness. That is, the topics will help you understand how your performance is positively or negatively affected by your communication encounters. · Identify the behaviors and artifacts of distinct organizational cultures/subcultures and how they affect communication in diverse workplaces. · Review and assess the value of applied materials for your potential audiences. · Delegate (or receive delegation) in a manner that enables the production of high quality, cost effective products. · Provide information to newcomers to facilitate their organizational entry. · Identify destructive workplace behaviors and know the intervention options available in one’s organization. · Learn how to be agile with your communication skills so that you are comfortable moving between theoretical and applied material. Policies and Procedures Grades will be lowered for students with more than 2 absences by a minimum of 1/3 grade (B+ to a B). Students with four or more absences will be advised to drop the course (if before week 12) because they risk failing the course. Unless you have instructor permission arriving late (within 15 minutes of start of class), leaving early, or spending excessive amount of time off camera counts 1/3 excused absence per incident. Turn off devices not being used for class activities. Students who are instant messaging, web surfing, or involved in other similar activities during class will be marked absent even if physically present in the classroom and receive significant deductions in class participation grade. All assignments must be the original work of the student and cannot have been used or currently submitted for any other academic course. Late assignments may receive lower grades. With the exception of submission due during the final exam period, I can typically allow up to a 48-hour extension – but after that a grade penalty should be expected. Any incident of academic integrity violation on either a draft or final submission of an assignment will be submitted to USC oversight committee for student conduct. Description, Submission and Assessment of Assignments Course Assignments (Detailed Information and Grading Rubrics in Brightspace) Component Points/Percentage of Final Grade 1. Capstone Project – Project Proposal and Annotated Bibliography 10 points/10% 2. Capstone Project – Theory/Literature Review 35 points/35% 3. Capstone Project – Application and revision of theory/literature review 35 points/35% 4. Capstone Project Presentation 10 points/10% 5. In-class Discussion and Brightspace Posts – Must be submitted by due date/time to receive credit 10 points/10% 6: Pay It Forward Article Report Article report from an article in an academic communication journal 2022 – 2025. 5 points/5% Total Percentage 100 points/100% *Active discussion requires that you read ahead of time and that you are engaged in the evening's session. Your participation grade is based on quality as well as quantity of comments. Attendance does NOT equal participation. USC prohibits any portion of a student’s grade to be based on his/her physical presence in the classroom. Grading Scale A 94.0% or higher A- 90.0% - 93.9% B+ 87.0% - 89.9% B 84.0% - 86.9% B- 80.0% - 83.9% C+ 77.0% - 79.9% C 74.0% - 76.9% C- 70.0% - 73.9% D+ 67.0% - 69.9% D 64.0% - 66.9% D- 60.0% - 63.9% F 59.9% OR LOWER A minimum grade of C is required to earn graduate units. Grading Standards Letter Grade Description A Excellent; demonstrates extraordinarily high achievement; comprehensive knowledge and understanding of subject matter; all expectations met and exceeded. B Good; moderately broad knowledge and understanding of subject matter; explicitly or implicitly demonstrates good, if not thorough understanding; only minor substantive shortcomings. C Satisfactory/Fair; reasonable knowledge and understanding of subject matter; most expectations are met; despite any shortcomings, demonstrates basic level of understanding. D Marginal; minimal knowledge and understanding of subject matter; more than one significant shortcoming; deficiencies indicate only the most rudimentary level of understanding. F Failing; unacceptably low level of knowledge and understanding of subject matter; deficiencies indicate lack of understanding.
Lab Exercises for COMP26020 Part 2: Functional Programming in Haskell November 26, 2024 The deadline for this lab is 6pm on 7/2/2025. This lab has three exercises, for a total of ten marks. The first two exercises together are worth eight marks, and I advise all students to focus exclusively on these exercises. Seven marks are given based on automated testing, and one is reserved for human judgement by the marker. These exercises are described in Section 1 below. Section 2 contains submission information and a checklist of tasks for the first two exercises. If you are certain that your solutions are completely correct you might like to look at Section 3 below, which describes a thought-provoking, open-ended exercise requiring significant creativity, worth two marks. It is designed to be extremely difficult, and is not a practical way of gaining marks! 1 Simple Quadtrees This lab exercise concerns as data structure called a ‘quadtree’ which can be used to represent an image. There are sophisticated versions of the quadtree data structure, but for the purposes of the lab we will use a very simple version of the idea. Suppose we want to represent a square, black and white bitmap image which is 2n by 2n pixels. The usual way to do this is as a 2n by 2n grid of bits, but this can be wasteful if there are large monochrome areas. In that case, a simple optimization is to think of the image as split into four sub-images of size 2n−1 by 2n−1 which we will call ‘quadrants’ . If the sub-image is all one colour, we can represent this by one bit of information. But if it contains different colours, we can subdivide again, and keep going recursively until we do get sub-images which are only one colour. (This definitely happens once we get down to the scale of the original pixels!). We call these single colour sub-images in the final data structure ‘cells’ . This lab exercise is about the resulting data structure, the tree of cells. You don’t have to care about the details of an original image which such a structure might have come from – for instance you don’t need to record the dimensions in pixels of the original image. That means that your data structure is correct if it represents the way the image looks geometrically, ignoring the size. Nor do you need to worry about whether a particular structure is the most efficient way of representing a given image. In fact it is useful to allow non-optimal quadtrees. The way you think about the data structure could differ from someone else by rotation, scaling, and even reflection, as well as the details of how you order and organize the various components, and you can both be correct as long as you are each internally self-consistent. For that reason, if you are working out what the exercises mean with a friend, or asking something on the forum, you should describe everything in terms of pictures, or describe quadtrees using the four functions in Exercise 1 below, so that you don’t accidentally discuss the details of your data structure. 1.1 Exercise 1: (3 marks) representing quadtrees For this exercise, you should define an Algebraic Data Type (that means a custom type defined by the data keyword) to model quadtrees in the sense described above. Do this in whatever way you like (as long as you use an Algebraic Data Type), but provide four functions with the following properties: • A function allBlack which takes an Int number n and returns your representation of a single cell which is all black. The argument n represents the image ‘size’, but since all-black images of any size look the same, you can ignore this argument! (See notes below...) • A function allWhite which takes an Int number n, as above, and returns your representation of a single cell which is all white. • A function clockwise which takes four quadtrees and returns the quadtree whose four subtrees are the given inputs, arranged in a clockwise order. • A function anticlockwise which takes four quadtrees and returns the quadtree whose four subtrees are the inputs, arranged in an anticlockwise order. Note the following: • For allBlack and allWhite the ‘size’ argument can be ignored, but for some ways of modelling it might be useful. Neither using the argument nor ignoring it is the ‘best’ approach: there are a huge number of different correct solutions! You can assume that any testing data come from real bitmaps (square bitmaps whose width is a power of 2), and the ‘size’ arguments tell us how many pixels wide each cell is in the originating bitmap. • A clockwise ordering means that in the tree clockwise a b c d, the sub- tree b is located in the quadrant next to a which is reached by moving clockwise, c is in the quadrant reached by moving clockwise from b, d is in the quadrant reached by moving clockwise from c, and a is in the quadrant reached by moving clockwise from d. • For clockwise and anticlockwise it doesn’t matter how subtrees are stored or ordered internally, or which quadrant comes ‘first’ – a correct solution is still correct if we rotate, reflect, or scale every quadtree and all tests involved in marking will respect this. However, the choices you make should be consistent: the clockwise and anticockwise orderings must be opposite to each other, and all uses of clockwise and anticlockwise in your solution should make the same choice about which quadrant the first argument goes in! You must use at least one Algebraic Data Type in your model, but you may use several. For each Algebraic Data Type, you must add the expression deriving (Eq, Show) to the end of the line which defines the datatype. For example, below is an Algebraic Data Type representing a list of Int values data MyList = Elist | Cons Int MyList If I used such a data structure in my solution, I would append the expression above to the end of the definition, to obtain data MyList = Elist | Cons Int MyList deriving (Eq, Show) Make sure you have done this for all the Algebraic Data Types you have defined. For now we treat this as a ‘magic incantation’ which lets Haskell know we want to be able to print values of our datatype and compare them for equality. What is really going on in this expression will be covered in the videos in the last week of the Haskell part. Note that the four functions completely specify how the quadtree is split up into cells.: it is best not to optimize when given an input which is not efficiently encoded. You won’t actually lose marks for this, but it makes exercise 2 harder if you optimize the tree structure! Marking Exercise 1 This exercise is has a total of three marks available. The marks will be assigned based on testing on quadtrees of different sizes and complexities. The tests will consist of checking consistency properties which we expect to hold. For example, we expect clockwise (allBlack 1) (allBlack 1) (allWhite 1) (allWhite 1) == anticlockwise (allBlack 1) (allWhite 1) (allWhite 1) (allBlack 1) The tests will also involve checking inequalities such as clockwise (allBlack 1) (allBlack 1) (allWhite 1) (allWhite 1) /= anticlockwise (allBlack 1) (allBlack 1) (allWhite 1) (allBlack 1) Otherwise you could represent all trees with a single value! Note however that they do not check anything which depends on the size of the image, so for instance they never check whether allBlack 128 == allBlack 2, because ge- ometrically these look the same, so you are free to represent them as the same or different, whichever works for your data structure. The tests only check equali- ties and inequalities which must hold for all correct representations. You solution will receive: • One mark for passing the tests on quadtrees described at most one use of clockwise or anticlockwise (so they either have 1 cell or 4 cells), • One mark for passing the tests on quadtrees which represent 4 by 4 images (they can have up to 16 cells, but may have fewer if they have an interesting structure), • One mark for passing the tests on all quadtrees, for a total of three marks. The quadtrees used for testing are no larger than required to represent a 210 by 210 image. You need only consider square images whose dimensions are powers of 2. Your solution must use at least one Algebraic Data Type to qualify for any of the marks above. 1.2 Exercise 2: (4 marks) A crude ‘blurring’ operation For this exercise, you should define a function blur which takes a quadtree as input and returns a quadtree as output. It should not change the structure of the quadtree1 , but it should change the data representing the black and white colours. To find the colour of a cell in the output blur q we look at all of its ‘neighbours’: other cells which touch it along an edge (or part of an edge), not just a corner. The colour of a cell in blur q should be the opposite of the colour of that cell in the input q if and only if more than half of its neighbours have the opposite colour in q. E.g. if a cell is black in the input q then it should be white in the output blur q if and only if in q more of its neighbours are white cells than black. You can think of such a function as an extremely crude approximation to a blurring operation, although it is not practical to use it for that purpose! For example and Note that cells at the border usually have fewer neighbours, so the definition behaves quite strangely there. For example which shows that in many cases the approximation to ‘blurring’ is very bad in- deed! The image below shows how many neighbours each cell of the quadtrees above has. Note that a cell is not one of its own neighbours. Coming up with a solution all at once is hard! For that reason, the mark scheme below gives most of the marks for solving special cases. It may be best to try the special cases first if you can’t see how to solve the whole problem straight away. To define the special cases, let us call a quadtree striped if it satisfies the following recursive specification: • Base case: For all Int values z (satisfyingtheconditionsfrom Exercise1), the quadtrees allBlack z and allWhite z are striped quadtrees; • Step case: If q1 and q2 are striped quadtrees, then clockwise q1 q1 q2 q2 is a striped quadtree. Try drawing some pictures of striped quadtrees by building up from the base case. Notice how q1 and q2 are repeated in the step case – this repetition means that we already know the values of a cell’s neighbours in one dimension. (Though we do still have to worry about whether is has any neighbours in the other dimension, or if it is on the border.) Marking This exercise is has a total of four marks available. The marks will be assigned based on testing on quadtrees of different sizes and complexities. The tests will consist of checking properties which we expect to hold. For example, blur (clockwise (allWhite 2) (clockwise (allBlack 1) (allBlack 1) (allBlack 1) (allWhite 1)) (allBlack 2) (allWhite 2)) == clockwise (allWhite 2) (clockwise (allWhite 1) (allBlack 1) (allBlack 1) (allBlack 1)) (allWhite 2) (allWhite 2) You solution will receive: • One mark for implementing a function blur of the correct type which does not ‘go wrong’ as long as its argument is a suitable quadtree (one which could come from a real image), • One mark for passing the tests on striped quadtrees which represent 1 by 1, 2 by 2, or 4 by 4 images (so have at most 16 cells), • One mark for passing the tests on all striped quadtrees, and • One mark for passing the tests on all quadtrees, for a total of four marks. The maximum size for test inputs is the same as for Exercise 1. One additional mark is available for the first two exercises according to the marker’s judgement. This mark will be given for clearly commented code which explains your solution or where you got stuck. But it may also be given for other good work towards solving any of the above if the marker feels, according to their judgement, that it is not reflected fairly in the automated mark. 2 Submission To submit the exercises above, clone the git repository 26020-lab3-s-haskell_ present in the department’s GitLab. In that directory, save your submission as submission.hs Remove any definition of main from submission.hs. Make sure you have done git add submission.hs. A testing script is provided called check_submission .sh (note ‘sh’ not ‘hs’!). Running this file checks that your submission will work with the au- tomated marking script. Please check at least once that you can run this suc- cessfully on a lab machine, as this is the set-up used to mark your code. Note that it creates/overwrites a file called check_submission_temp_file .hs by concatenating submission.hs and two testing files. It does not remove this file after running, so you can inspect it if anything went wrong. This script checks that your solution is in the right format for the auto- mated tests (e.g. that you have used the right function names, added the deriving (Eq, Show) incantation where necessary, and have remembered to remove any definition of main) but it does not test your submission well! Come up with your own test examples, and reason about whether your code is correct for all inputs! You might have to make check_submission .sh executable by running chmod u+x check_submission .sh. Once check_submission .sh tells you that all its checks have passed, double check that you have added submission.hs and push the files on the master branch. If you decide to try the creative exercise below and think you have succeeded or very nearly succeeded, add your work to the repo as creative .hs. Students are strongly encouraged to focus on the exercises above. Once you are confident that your solution is correct (i.e. after doing more testing than just running the format checking script!), push your final version on the master branch and create a tag named lab3-submission to indicate that the submission is ready to be marked. In most cases marking will be done without any further input needed from you once you have submitted, but in some cases we may need you to explain your solution face-to-face in order to complete marking. Talking to each other and using the internet When talking to other students about the coursework, keep in mind some “do”s and “don’t”s: • Do discuss what the exercise means, e.g. what the function blur does to examples in terms of inputs and outputs. • Do discuss example quadtrees in terms of pictures or geometry which doesn’t change when rotated, translated, or scaled. • Do discuss example quadtrees in terms of the four functions allBlack , allWhite , clockwise and anticlockwise. • Do discuss general Haskell questions,e.g. how to write an Algebraic Data Type using data, how Maybe or lists work, how to bracket when defining recusive functions, etc. But: • Don’t discuss quadtrees using terminology not in this lab script – that probably contains ideas about how your solution works! • Don’t discuss how to define a data structure for quadtrees (inlcuding for instance where your solution puts which quadrant of the pictures) • Don’t discuss how to define blur or similar operations in terms of recur- sive functions • Don’t show anyone your solution to get help with Haskell syntax – instead try to describe the problem in general or reproduce it in an unrelated example Talking to others is an important way to learn a subject, and I encourage you to discuss Haskell in general. When discussing the lab exercises with other stu- dents, stick to the rules above. Similarly, when using the internet to help with this coursework • Do use non-interactive resources like tutorials and documentation. I rec- ommend – https://en.wikibooks.org/wiki/Haskell/Other_data_structures – https://www.haskell.org/tutorial/goodies.html • Do ask general Haskell questions (not based on the lab exercises!) in forums, chatrooms etc. But: • Don’t discuss anything derived from the lab exercises on interactive ser- vices like forums, chatrooms, ‘AI’ chatbots, Stack Exchange, etc. • Don’t upload the lab script or anything derived from lab work to file- sharing websites, document-sharing websites, or notes-sharing websites. Checklist for Exercises 1 and 2 Exercise Task Marks Done? 1 Create a data type using data to model quadtrees 1 Ensure any data type declarations you use end with deriving (Eq,Show) 1 Write the allBlack function 1 Write the allWhite function 1 Write the clockwise function 1 Write the anticlockwise function 1 Ensure the functions work for quadtrees with between 1 and 4 cells 1 mark 1 Ensure the functions work for quadtrees with at most 16 cells 1 mark 1 Ensure the functions work for all quadtrees 1 mark 2 Write a function blur from quadtrees to quadtrees (which does anything!) 2 Ensure your function does not ‘go wrong’ for any well-defined input 1 mark 2 Make the blur function work correctly for striped quadtrees with at most 16 cells 1 mark 2 Make the blur function work correctly for all striped quadtrees 1 mark 2 Make the blur function work for all quadtrees 1 mark all Document your code clearly with comments 1 mark all Thoroughly test and reason about your solutions all Test your submission using your own test data all Remove any definition of main from your submission all Run check submission.sh and make sure there are no errors all Make sure you have added submission.hs, pushed, and tagged your submission correctly 3 An open-ended exercise The exercise described in this section is designed to be extremely difficult: no amount of time spent on it is guaranteed to result in gaining marks, and it is best attempted only if the thinking in itself is sufficient motivation. In partic- ular, it will only be marked if your submission for exercises 1 and 2 receive full marks. I have told the TAs that they do not need to prepare to support these exercises, so you may need to ask me directly about any questions you have! For this exercise, we assume that quadtrees do not record any size informa- tion about their cells. If your data structure for Exercises 1 and 2 records size information, make a different Algebraic Data Type for this exercise which does not do so, and provide implementations for the four functions from Exericse 1, except that allBlack and allWhite should now take no arguments. Note that you should do this exercise in a separate file, so that you don’t modify anything to do with your existing solutions! This means we can now write infinite quadtrees, such as let q = clockwise allWhite allBlack allWhite q in q which form the basis of the exercise. First, we define a notion of approximation for quadtrees for each natural number n which we call the nth coarse work approximation. This is specified by the following equalities: • coarsework 0 q == allWhite • coarsework n allWhite == allWhite • coarsework n allBlack == allBlack • coarsework (n+1) (clockwise a b c d) == clockwise (coarsework n a) (coarsework n b) (coarsework n c) (coarsework n d) A value q of the quadtree type is called ergodomestic if for all natural numbers n the expression coarsework n q does not ‘go wrong’ in the sense we have been using that phrase heretofore. A function which takes a quadtree as input and outputs a Bool is called a fair exercise if and only if when given an ergodomestic quadtree, it evaluates to either True or False in finite time. Your task is to define a function my_solution which takes as input a function from quadtrees to Bool and outputs a quadtree, with the property that for all fair exercises f, my_solution evaluates in finite time to a quadtree (which may be finite or infinite), and we have the following equations: • f (my_solution f) == True if there exists a value of the quadtree type q such that f (q) == True , and • f (my_solution f) == False if there is no such value. A correct, well-documented solution is worth two marks. (Anything else may get zero marks!)
CMT120 Fundamentals of Programming Web Application Development Learning Outcomes • LO3: Develop secure web applications that make use of database technologies • LO4: Critically appreciate the role of security, quality and usability within software projects Submission Instructions The coversheet can be found under ‘Assessment & Feedback’ in the COMSC-ORG-SCHOOL organisation on Learning Central. All files should be submitted via Learning Central. The submission page can be found under ‘Assessment & Feedback’ in the CMT120 module on Learning Central. Your submission should consist of multiple files: Description File Type File Name Location (0) Coversheet .pdf file Coversheet.pdf Learning Central (1) git repository on COMSC’s GitLab server complete source code of website Repository name should be: YOUR_USERNAME_cmt120_cw2* https: //git.cardiff.ac.uk/ (2) video demo of the website .mp4 file YOUR_USERNAME_demo .mp4 *,** Learning Central (3) report on your website’s quality, usability and security .pdf file YOUR_USERNAME_report.pdf * Learning Central (4) Coursework submission Details Form online form submission ’CMT120 - CW 2 - Submission Details Form (24-25)’ link will be posted in ’Assessment’ area on Learning Central * Replace YOUR_USERNAME with your Cardiff’s user name, which is typically a letter ’c’ (or ’d’) + your student number, e.g. c1234567. ** In case of problems uploading the video to Learning Central, please share it through OneDrive to Jandson Santos Ribeiro Santos ([email protected]) and Federico Liberatore ([email protected]) . More specifically: • For item (1) : – submit (push) your complete source code to COSMC’s GitLab server, and share your repository with Jandson Santos Ribeiro Santos and Federico Liberatore as follows: * On the Project page, go to: Project Information > Members * In GitLab member or Email address field: search for Jandson Santos Ribeiro Santos (user name: scmjs8) * In Select a role dropdown, choose Maintainer * Click on Invite button Repeat for Federico Liberatore (user name: scmfl2), making sure the role permission is also set as Maintainer. – Your git repository must include a README text file ( .md or .txt), which contains the following information: * Your Username (or Student Number) * (If deployed on OpenShift) URL of your website on the OpenShift server; * [Optional] References (if appropriate). * [Optional] Any other information you think is relevant, e.g. how to run your code. – Note: no changes are allowed after the submission deadline! Non compliance with this requirement,i.e. working on the coursework after the deadline, may be penalised and may result in capping the mark at the pass rate (for the work submitted < 24 hrs late) or an award of zero marks (> 24 hrs late submission). • For item (2) - see instructions in Section ’2Video Demo of the Website’ . • For item (2) - specific requirements for your report on the website’s security and usability are given in Section ’3Report on Website’s Security, Quality and Usability’ . • For item (4) - you will need to fill in and submit the online ‘CMT120 - CW 2 - Submission Details Form (23-24)’ form, the link to which will be posted in ’Assessment’ area on Learning Central. Any code submitted will be run on a system equivalent to the laptops provided to the students, and must be submitted as stipulated in the instructions above. The code should run without any changes being required to the submitted code, including editing of filenames. Any deviation from the submission instructions above (including the number and types of files submitted) may result in a deduction of up to 10% from the overall mark. Staff reserve the right to invite students to a meeting to discuss coursework submissions. If you are unable to submit your work due to technical difficulties, please submit your work via e-mailto [email protected] and notify the module leader. Assessment Description For this coursework, you are asked to: 1. Implement a personal digital portfolio in the form of a dynamic website, which showcases your competences, skills and expertise, e.g. your technical skills, work produced to date, previous work experience, etc. - the choice of what you want to cover it’s up to you, but make sure you cover a reasonable range of these. 2. Record a short 3-mindemo of your website. 3. Write a report to evaluate your website’s quality, usability and security. 1 Personal Digital Portfolio as Dynamic Website 1.1 Website Implementation • The website is to be implemented using any appropriate tools and methodologies, covered in this module, e.g. JavaScript, Python/Flask, HTML, CSS, databases, etc. • The majority of your website content must be ’dynamic’, i.e. appropriate data and content are pulled from/pushed to a database. - Examples of dynamic content include, but are not limited to: interaction with the user (e.g. user comments or rating), user accounts, automatically generated web pages. - You can employ any type of database system/service. • Use of external libraries, extensions and APIs is allowed, e.g. Flask-WTF, Flask-Security, Bootstrap. However, the final code must be authored by you. You are reminded of the need to comply with Cardiff University’s Student Guide to Academic Integrity. If you use external resources, you must provide complete references, e.g. as in-line comments in your code, and/or in README.md file. Evidence of unfair practice will be penalised. • Use of the code you developed when working on the lab exercises for this module is allowed. • Although it’s advisable to use the university laptop, you can use your own computer to implement your website. However, you must use School-based systems and servers for hosting ’dynamic’ parts of your website, e.g. database for content and user accounts, deployment server. The use of external services for these elements is not allowed. • Complete code of your website must be submitted to COMSC’s GitLab server (https://git.cardiff.ac.uk/) and shared with the module lecturers - complete instructions on how to do it are given in ’Submission Instructions’ section below. 1.2 Structure and Functionality of the Website You are free to choose how to structure your website, and what functionality to implement,bearing in mind that appropriate advanced functionality will attract higher marks - see ’Assessment Criteria’ section below. 1.3 Deployment of Website The expectation is that initially you will be implementing and deploying your website on localhost. Deployment of your website on a localhost will allow for a mark up to a ’Pass’ for the website implementation part. To obtain a higher mark, your website needs to be deployed on COMSC’s OpenShift server - see ’Assessment Criteria’ section. The process is described in ’Flask 4: Deployment on OpenShift’ lab sheet and is demonstrated in the practical session. Make sure you state the correct URL in your REAMDE.md submitted in your git repository on GitLab and in your report. If this is missing or incorrect, it will be assumed that you have not deployed your website on OpenShift. 2 Video Demo of the Website Record a short video demo of maximum 3 minutes, which demonstrates the functionality you implemented on your website. If you have successfully deployed your website on OpenShift, you should clearly demonstrate you are running your website using the URL you submitted in your REAMDE.md file. More detailed instructions will be provided in the contact sessions. 3 Report on Website’s Security, Quality and Usability Write a report of 800 words (± 10%), in which you critically appraise TWO examples from your website implementation that demonstrate your appreciation of best practice in security, quality and usability (choose any two). The front page of your report must contain: • Your student number • URL of your website on OpenShift (if deployed) Your report must also include two appendices at the end of your report: • Appendix A: list of advanced functionality you have implemented; • Appendix B: screenshots of all of your website’s pages.
International Year One in Business INU1111 Quantitative Methods Summative Assignment Assignment Part B: Data Analysis Report (75% of final mark) Distribution and Submission Details Due Date: Assignment Part B: - Due Monday 31st March 2025 (9.00am UK time) Submission through Turnitin. Please Note: Ø Late or plagiarised assignments will be penalised, marks will be deducted for late submission. Assignment guidelines: · Using the Assignment Part B guidance on Canvas continue with the data analysis of your sample of data. Your written work in Assignment Part A forms part of your final Assignment Part B report. · Maximum report size 16 sides of A4, maximum word count 3000 words. This includes your graphs, but excludes the front page, contents page, reference list and appendix. Assignment Part B: 75% of the module mark. In the second larger part of the assignment, you will analyse your data in depth using a variety of methods. This analysis must include the following sections. 1.0 Introduction Use the introduction you wrote for Assignment Part A as the basis for this section. Make any amendments that were mentioned in the feedback for Part A. 2.0 Sample Method Provided a detailed explanation of your sample method. Use the sample method you wrote for Assignment Part A as the basis for this section. Include any adjustments you have made (for example, if you have since added to or changed your data based on feedback from Part A). As a reminder, your sample method should discuss. · The sampling methodology you have used. · Your sample sizes per group. · How you have controlled your sample (e.g., only used certain locations or video types) · Any limitations in the data that may influence the results. 3.0 Initial analysis of your data · This is the first part of your analysis. The purpose of this section is to look at your two numerical variables individually. · Use the descriptive statistics and graph that you created for ‘The Number of Views’ in Assignment Part A as a starting point. Then repeat this process by creating a second set of descriptive statistics and graph for your other numerical variable. · Include a comparison between two groups (for example, comparing locations or video types). 4.0 Regression and Correlation Analysis · Use simple linear regression and correlation analysis with accompanying graphs to analyse the relationship between your key variables. Discuss your regression equation. · Test your regression equation and interpret the results. · Explain whether your independent variable is a good predictor for your dependent variable. Consider the correlation (r) and the coefficient of determination (the R-square value). If the independent variable does not explain 100% of the variation in the dependent variable suggest reasons why this could be the case. Important Guidance: use a simple regression model in this section, do not use a Multiple Regression Model. The aim here is to investigate a relationship between two variables whilst identifying and discussing the problems, it is not to find the best model. 5.0 Further Analysis Carry out the hypothesis test assigned to you in Semester 2 Week 7. 6.0 Conclusion · Summarise your findings from each of the three analysis sections (Initial Analysis, Regression and Further Analysis) 7.0 References Include a range of references. These should be in the Harvard Reference format. Each reference should feature in the report as a citation and each citation must have an accompanying reference. 8.0 Appendix Include a copy of your raw data as a table in an appendix at the end of the report. Marking Breakdown for the Assignment Sections · Introduction to the topic and explaining the sample selection process in detail (10 marks) · Initial analysis of your data using summary statistics and graphs (30 marks) · Calculating the regression equation and correlation coefficient. Discussing the regression equation. Making appropriate comments about the regression and correlation results. Testing the equation and discussing the validity of the regression equation (30 marks). · Hypothesis test (25 marks). · Conclusion discussion (5 marks) Please refer to the Quantitative Methods module handbook for a breakdown of the grade descriptors (what is required to reach each marking band).
LGT 5431: Homework Assignment Linear Programming Due 11:59pm Wed, Feb 5 Instructions: You must submit your solutions via the LEARN@PolyU Assignment tab by 11:59 pm on Wednesday, February 5. Any submission after this will be marked “ late” in LEARN@PolyU and will be penalized severely. Please make sure you submit on time. What to submit to LEARN@PolyU: Your homework write-up -- answers to the questions below. This can be a Word file or pdf. Note that you may hand-write your solutions. If you do, you should scan your answers and upload the files as one pdf document. Any handwritten solutions should be neat and easily legible. We cannot grade them if we cannot read them! If the homework involves work on Excel, please remember to submit the corresponding Excel files as well. What to bring to class on Feb 6: You must turn in a hard copy of your homework; they should be identical to the files you uploaded to LEARN@PolyU. Any variation will be treated as a violation of the honor code. Do not bring hard copies of your Excel spreadsheets! PARTIAL CREDIT IS AVAILABLE for the following questions, provided that your work is shown and clearly interpreted. 1. Agri-Pro is a company that sells agricultural products to farmers in several states. One service it provides to its customers is custom feed mixing, whereby a farmer can order a specific amount of livestock feed and specify the amount of corn, grain, and minerals the feed should contain. Agri-Pro stocks bulk amounts of four types of feeds that it can mix to meet a given customer’s specifications. The following table summarizes the four feeds, their composition of corn, grain, and minerals, and the cost per pound for each type. Percent of Nutrient in Nutrient Feed 1 Feed 2 Feed 3 Feed 4 Corn 30% 5% 20% 10% Grain 10% 30% 15% 10% Minerals 20% 20% 20% 30% Cost per pound $0.25 $0.30 $0.32 $0.15 Agri-Pro has just received an order from a local chicken farmer for 8000 pounds of feed. The farmer wants this feed to contain at least 20% corn, 15% grain, and 15% mineral. What should Agri-Pro do to fill this order at minimum cost? (a) [3 points] Define the following decision variables: X1 = pounds of Feed 1 to use in the mix X2 = pounds of Feed 2 to use in the mix X3 = pounds of Feed 3 to use in the mix X4 = pounds of Feed 4 to use in the mix Write down in the space below the objective function and constraints, for the optimization problem to help Agri-Pro decide the amount of each feed to fill the order at minimum cost. Objective function: Constraints: (b) [3 points] Set up an optimization model in Excel to solve this problem. Solve it using Solver. In the space below, report the objective function value found by Solver, as well as the recommended amount for each feed. For full credit, you must submit your complete spreadsheet in your completed Excel file on LEARN@PolyU. Objective Function Value Feed 1 Feed 2 Feed 3 Feed 4 Please perform. the analysis based on the sensitivity reports provided below, which may be different from what you obtained in Part (b). (c) [3 points] Using the sensitivity table above, what will happen if corn requirement is increased from at least 20% to at least 21%? Explain with reference to the quantities from the sensitivity report. a. Cost will increase by $5 b. Cost will increase by $40 c. Cost will increase by $50 d. It is outside the allowable increase and we need to resolve the LP 2. Hong Kong Farm, a land and farming company, plans to grow two types of vegetables: tomato and green pepper. The company wants to maximize its net profit (i.e., gross revenue minus operating cost) subject to budget, time (in man days) and land constraints. The expected gross revenue, operating cost, time and land requirements for each unit of tomato and pepper are: Vegetables Gross Revenue Operating Cost Time (man days) Land Requirement Tomato $800 $500 12 1 Pepper $600 $250 24 1 The company has set aside a $15,000 budget, a total of 720 man days of time, 45 acres of land. From past experience, the company decides that the amount of tomato should be at least half the amount of green pepper and at most twice the amount of green pepper. (a) [4 points] Write down in the space below the decision variables, objective function, and constraints, for the optimization problem to help Hong Kong Farm decide the amount of vegetables to grow. Note that fraction of a unit is allowed. Decision variables: Objective function: Constraints: (b) [3 points] Set up an optimization model in Excel to solve this problem. Solve it using Solver. In the space below, report the objective function value found by Solver, as well as the recommended amount for each type of vegetable. For full credit, you must submit your complete spreadsheet in your completed Excel file on LEARN@PolyU. Objective Function Value Tomato Green Pepper Parts (c) and (d) are separate questions, which are unrelated to each other. Please perform the analysis based on the sensitivity reports provided below, which may be different from what you obtained in Part (b). (c) [3 points] A new Consumer Reports predicts that the revenue of tomato will be $670 per unit. Should the company change its plan? Explain with reference to the quantities from the sensitivity report. (d) [3 points] After surveying the land, the company finds that 5 acres of land are actually not suitable for growing vegetables (i.e., only 40 acres are available for growing vegetables). How does the company’s net profit change? Explain with reference to the appropriate quantities from the sensitivity report.
